Выписка из ифнс бесплатно: Выписка из ЕГРЮЛ по ИНН

Содержание

Как получить выписку из ЕГРИП бесплатно — Контур.Экстерн — СКБ Контур

Выписка с портала ФНС

К порталу Федеральной налоговой службы стоит обращаться, если вам нужна юридически значимая выписка, равная по значению аналогичной выписке на бумаге.

Чтобы получить выписку, зайдите в специальный сервис ФНС.

Если вы не зарегистрированы, перейдите по ссылке «Регистрация». Укажите адрес электронной почты, пароль и запрашиваемые сведения. После этого введите цифры с картинки и нажмите «Продолжить». На ваш e-mail уйдет письмо со ссылкой об активации. Останется только зайти в почту, перейти по ссылке и активировать учетную запись. 

Чтобы получить выписку, войдите в сервис по логину-паролю. Введите ИНН, ОГРНИП или ФИО ИП, затем выберите регион и нажмите кнопку «Найти». После этого вы получите список предпринимателей, подходящих под ваше описание, — выберите нужного. 

Выписка, сформированная в формате PDF, будет содержать усиленную квалифицированную электронную подпись ФНС и ее визуальное изображение — оно отразится и на распечатанном документе.

Выписка ЕГРИП из Контур.Экстерн

У абонентов системы интернет-отчетности Контур.Экстерн есть возможность получить информационную выписку из ЕГРИП.

В Контур.Экстерне выберите в меню справа в разделе «Сервисы для бухгалтера» пункт «Выписки из ЕГРЮЛ, ЕГРИП и проверка контрагентов» и укажите ИНН, ОГРНИП, название, адрес. Появится список, в котором есть совпадения с введенными данными. Нужно войти в необходимую карточку и нажать на «Сформировать выписку» в разделе «Выписка из ЕГРЮЛ/ЕГРИП». При необходимости выписку можно распечатать. Если на выписке нужна подпись налоговой выберите опцию «Запросить с подписью ФНС». Выписки можно сформировать задним числом, если заменить «сегодня» на нужную дату. 

Пользуйтесь всеми возможностями Контур.Экстерна

Отправить заявку

Отчитывайтесь во все


контролирующие органы

Как получить выписку из ЕГРЮЛ с ЭЦП для налоговой

В процессе работы с государственными интернет-ресурсами выписка из EГPЮЛ с ЭЦП заменяет собственноручно поставленную подпись. Выпиской пользуются для сдачи отчетной документации, ее принимает налоговый департамент или на торгах. Электронный документ равнозначен собственноручной подписи, поставленной должностным лицом ИФНС.

Зачем нужна выписка из ЕГРЮЛ

Для налогового электронного документооборота выписка из EГPЮЛ с ЭЦП аналогична собственноручной подписи. PDF-формат документа принимают нотариальные конторы. Выпиской пользуются для решения вопросов на интернет-площадках по решению финансовых вопросов.

Выписка подходит для участия:

  • в торгах;
  • в аукционах;
  • в котировках;
  • в закупках;
  • в тендерах;
  • в конкурсах;
  • при продаже ООО;
  • в проверке контрагента;
  • для открытия банковского счета.

До 2017 года для работы предъявлялся бумажный оригинал или копия документа. С конца 2018 года в силу вступило положение, по которому электронный формат получил аналогичный оригиналу статус.

Документ удобен в работе с нотариусом, во время проведения нотариальных операций его представление заменяет собственноручную подпись. Новый статус сделал из выписки удобный инструмент для работы с внутренним документооборотом. Он упрощает процедуру принятия решений. Выписка участвует во внутреннем контроле. Используется для выставления первичной документации, определения данных о регистрации компании и учредителях.

Виды выписок из ЕГРЮЛ

У выписки из EГPЮЛ 2 вида: стандартная и с расширенной информацией. В образце стандартного типа содержится информация о владельце организации. Сюда входят данные о сумме уставного капитала, названии, дате создания компании и лицензии. Право доступа к стандартной версии имеет любой заявитель.

Стандартная выписка включает:

наименование компании

дата создания

сумма уставного капитала

лицензии

Доступ к расширенной версии имеют государственные органы и руководитель предприятия. В документе содержится более подробная информация об организации. С помощью выписки возможна глубокая проверка организации для подтверждения ее надежности и допуска к сделке или операции.

Расширенная версия доступна государственным органам и руководителю предприятия, она содержит такие данные, как:

  • Все варианты названия компании, в том числе и устаревшие (если таковые есть).
  • Дата создания и регистрации в ФНС.
  • ИНН.
  • Коды видов деятельности.
  • Адрес и контактный телефон.
  • Величина уставного капитала компании.
  • Данные об учредителях, включая и их доли в уставном капитале.
  • Если один из учредителей является юридическим лицом, то всю информацию о нем.

Выписки выдаются на бумажном носителе или в электронном варианте. Бумажная выписка имеет вид сшитого документа. В нем проставляются мокрые печати и собственноручно проставленные подписи. Документ состоит из прошитых нескольких листов. Электронная форма выполняется в PDF-формате, подкреплена квалифицированной подписью.

Об электронном формате: что такое выписка с ЭП

Поданная налоговым службам выписка EГPЮЛ, содержащая ЭЦП, удостоверяет право подателя на доступ и передачу информации. Документ подтверждает право лица на участие в финансовых операциях. В данных выписки включена полная информация, подкрепляющая статус обращающегося и его полномочия.

Удобство документа в том, что его используют в полученном формате. Электронную форму не нужно распечатывать. В противном случае она теряет статус правового документа. Передача электронной версии разрешена на флеш-носителе или компакт-диске. Допускается подача EГPЮЛ в электронном письме через почтовые службы. Выслать выписку можно через файлообменник или аналогичный сервис. Это быстрый и удобный способ подтверждения своих прав для любых операций.

Важно!

Если выписка с ЭЦП была выдана в электронной форме, а затем распечатана, то печатная форма не имеет юридической значимости.

Электронная выписка из реестра — замена бумажному документу?

Электронный, заверенный квалифицированной подписью вариант выписки имеет силу хождения бумажного эквивалента. Налоговая служба выдает выписки в обоих вариантах. Электронная форма не принимается только в случае отсутствия технических возможностей у объекта, куда подается документ. В этом случае необходимо повторно подать заявление на бумажном носителе данных. В остальном электронная форма заменяет бумажную. С ее помощью можно заверить соглашение или операцию у нотариуса. Она дает доступ к совершению сделок, принятию ключевых решений и проведению операций с капиталами компании. Цифровая форма позволяет подписать соглашения о кардинальной смене деятельности организации.

Достоинства: электронный вариант бесплатный, в отличие от бумажного эквивалента. Получить выписку в электронном виде можно уже через 5 дней после подачи заявки.

Учитывая возможности цифровой выписки и удобство ее использования, она более удобный вариант для совершения сделок и операций. Мобильность экономит время проверки данных о владельце, что удобно для многих процедур, связанных с торгами и аукционами.

Важно!

Электронная выписка из реестра ЕГРЮЛ с ЭЦП служит заменой бумажному документу.

Как получить выписку ЕГРЮЛ

Заказать получение выписки за юридическое лицо можно на сайте ФНС. ЕГРЮЛ является открытым ресурсом. Выдача документального или электронного носителя данных разрешена любому лицу или организации. Данные выдаются на юридическое лицо, организацию или гражданина. Для получения выписки необходимо подать заявление и оплатить государственную пошлину.

Запрос подается в письменном виде после оплаты пошлины. К заполненному бланку заявления прикрепляется копия квитанции из банка. Если информация получается за другое лицо, нужна доверенность от руководителя, отвечающего за юридическое лицо.

Документальные выписки выдаются на платной основе. Электронный вариант предоставляется бесплатно. Получить выписку можно из любого региона РФ через службы ФНС.

Получить выписку из ЕГРЮЛ можно двумя способами:

Способ 1. На сайте ФНС: Способ 2. Через портал Госуслуг:
Получение выписки с ЭЦП налоговой проходит в несколько этапов:
  • Пройти регистрацию на сайте Федеральной налоговой службы.
  • Войти в учетную запись.
  • Подать заявку на странице service.nalog.ru/vyp/, ввести ОГРН и ИНН.
  • После обработки заявки на странице появится ссылка на скачивание.
  • Пройти регистрацию на портале.
  • Войти в личный кабинет.
  • Сформировать запрос и дождаться получения ссылки.
Важно!

Выполнить эту процедуру могут только те пользователи портала, у которых есть своя электронная подпись, а аккаунт идентифицирован.

Проверка оригинальности выписки ЕГРЮЛ с ЭП налоговой

Проверка подлинности документа электронного формата проводится с помощью установки специализированного ПО. Определение правдивости информации проходит через сертификат УЦ ФНС.

ПО для проверки:

  • Adobe Reader или Adobe Acrobat— бесплатное ПО для работы с PDF-документами;
  • «КриптоПро PDF» — с плагином обеспечивается совместимая работа криптопровайдера и Adobe Acrobat;
  • Криптопровайдер — ПО рассчитано для работы в ОС Windows. Пробная бесплатная версия дается на 3 месяца, после покупается подписка.

После установки всех программ на сайте налоговой скачивается инструкция по настройке. Только после пусконаладочных работ возможна проверка документа.

Если в ходе проверки определится, что информация о юрлице неполна или неверна, выдается справка с указанием на ошибку.

Важно!

Выписка из EГPЮЛ упрощает и ускоряет работы с документооборотом, проведение торгов или финансовых операций. Документ выдается в документальном виде на платной основе и в электронной форме на бесплатной основе. Срок ожидания выписки — от 5 дней. Получить выписку можно за юридическое лицо, подав заявление и оплатив пошлину. Проверку подлинности данных в документе можно провести, установив и настроив соответствующее ПО. В случае неполных или неверных данных выдается справка об ошибке.

А если данные о юридическом лице вымышленные?

Может случиться и так, что вами будет введена неверная информация или переданы для проверки ошибочные сведения. В этом случае будет выдана справка «Об отсутствии запрашиваемой информации».

Что делать, если электронную выписку не принимают?

Если вам отказали в приеме электронной выписки, придется получить бумажный вариант. Для этого необходимо оплатить госпошлину через платежный терминал. Квитанцию распечатать и сохранить. Обратиться в налоговую или МФЦ для формирования запроса.

Получить бумажную выписку из ЕГРЮЛ можно лично (доверенным представителям юрлица, если выписка расширенная) или через посредника (также по доверенности), который не только получит, но и принесет документ в назначенное место, например, в банк.

Что говорит закон о выписке ЕГРЮЛ с ЭЦП?

Согласно ст. 6 Федерального закона от 08.08.2001 N 129-ФЗ сведения об организациях предоставляются в т.ч. путем формирования выписки из реестра. Порядок такого предоставления урегулирован в специализированном регламенте (утв. Приказом Минфина от 15.01.2015 N 5н).

Проставление ЭЦП на подобной информации регламентировано Федеральным законом от 06.04.2011 N 63-ФЗ.

Признаки используемых для этих целей подписей таковы:

  • применение ключа подписи;
  • возможность идентифицировать человека, подписавшего документ;
  • с ее помощью можно отследить изменения в электронном документе;
  • ключ проверки КЭП прописывается в специальном сертификате;
  • для КЭП применяются специальные средства, соответствующие отдельным требованиям законодательства.

Согласно ст. 6 Закона от 06.04.2011 N 63-ФЗ документ в электронной форме, закрепленный КЭЦП, равнозначен бумажной форме документации, подписанной вручную. Такой документ (в т.ч. выписка из ЕГРЮЛ с усиленной электронной подписью) может быть использован в любых правоотношениях, если иное не предусмотрено отечественным законодательством.

На равнозначность подобной документации указало Минэкономразвития в письме от 01.12.2015 N Д28и-3448, рассматривая вопрос о возможности представления для участия в запросе котировок выписки из ЕГРЮЛ с ЭЦП налоговой. Предоставление содержащихся в ЕГРЮЛ сведений различным органам власти и судам сопровождается подписанием усиленной КЭЦП соответствующей выписки.

В качестве дополнительной информации сообщаем, что для обратного взаимодействия с налоговиками, таможенными органами, а также в целях подписания электронных счетов-фактур субъектами предпринимательства тоже применяется квалифицированная электронная подпись. Для подписания же первичных бухгалтерских документов могут применяться и КЭЦП, и неквалифицированная подпись, и даже простая ЭЦП. При этом все эти средства должны противостоять угрозам, направленным на нарушение безопасности информации, защищаемой ЭЦП.

Из п. 3 Постановления Пленума ВАС РФ от 17.02.2011 N 12 следует, что такая выписка может служить документом, подтверждающим информацию о месте нахождения истца и ответчика для целей арбитражного процесса. Для того чтобы получить выписку с информацией об организации, следует в поисковой строке специализированного портала на сайте ФНС указать ОГРН или ИНН соответствующего лица. Также возможно осуществить поиск и при помощи указания наименования организации и территории ее нахождения.

Преимущества электронной выписки перед бумажной:

Не требуется личное
посещение и стояние в
очередях

Экономия времени. С момента
заявки до получения
бумажного варианта пройдет 5
дней, при онлайн-заявке
запрос будет выполнен уже на
следующий день

В отличие от бумажного
документа электронная
 выписка с ЭЦП налоговой
 бесплатная

К недостаткам стоит отнести лишь то, что пока не везде принимают электронный вариант.

Где получить ЭЦП?

Чтобы упростить работу и взаимодействие со многими учреждениями и коммерческими организациями, стоит приобрести электронно-цифровую подпись. Выдают ЭЦП только авторизированные удостоверяющие центры, входящие в официальный список.

За получением ЭЦП вы можете обратиться и в наш Удостоверяющий центр.

Предоставление выписки из Единого государственного реестра налогоплательщиков (ЕГРН) В избранное

Обжалование решений и (или) действий (бездействия) налоговых органов и (или) их должностных лиц при предоставлении государственной услуги, рассмотрение соответствующих жалоб и принятие решений по ним осуществляются в порядке, установленном разделом VII Налогового кодекса Российской Федерации.

Предметом жалобы являются решение, действие (бездействие) налогового органа, его должностных лиц при предоставлении государственной услуги (жалоба), которые, по мнению заявителя, нарушают его права и законные интересы.

Жалоба может быть направлена вышестоящему налоговому органу в соответствии со статьями 138 и 139 Налогового кодекса Российской Федерации.

Жалоба подается и подлежит рассмотрению (оставляется без рассмотрения) в соответствии со статьями 138, 139, 139.2 —140 Налогового кодекса Российской Федерации.

Жалоба подлежит рассмотрению в сроки, предусмотренные статьей 140 Налогового кодекса Российской Федерации.

Основания для приостановления рассмотрения жалобы отсутствуют.

По результатам рассмотрения жалобы вышестоящим налоговым органом, рассматривающим жалобу, принимается решение в соответствии с пунктом 3 статьи 140 Налогового кодекса Российской Федерации.

Решение о результатах рассмотрения жалобы вручается (направляется) заявителю, подавшему эту жалобу, в соответствии с пунктом 6 статьи 140 Налогового кодекса Российской Федерации.

Решение по жалобе вручается (направляется) заявителю в письменной форме или по просьбе заявителя в электронной форме.

Решение по жалобе может быть обжаловано в порядке, предусмотренном пунктом 2 статьи 138 Налогового кодекса Российской Федерации.

Право заявителя на получение информации и документов, необходимых для обоснования и рассмотрения жалобы, осуществляется в соответствии с Налоговым кодексом Российской Федерации.

Информирование заявителей о порядке подачи и рассмотрения жалобы осуществляется в соответствии с пунктом 12 административного регламента.

Получить выписку из егрюл из фнс

Единый государственный реестр юридических лиц ЕГРЮЛ — федеральный информационный ресурс, содержащий общие систематизированные сведения о всех юридических лицах, осуществляющих предпринимательскую деятельность на территории Российской Федерации, а также, в ряде случаев, о ликвидированных и находящихся в процессе ликвидации организациях. Сведения, содержащиеся в выписке из ЕГРЮЛ, являются ключевыми при проверке контрагента и, наряду с прочими документами, могут подтверждать право собственности, права учредителей или руководства организации на заключение договоров и совершение других юридически значимых действий от лица юридического лица ЮЛ , а также дают ценную информацию о состоянии ЮЛ и общей надежности контрагента. Она не содержит паспортные данные учредителей и руководителей юридического лица, а также сведения о банковских счета организации. Информация всегда актуальна на текущую дату. Расширенная выписка — содержит полную информацию, в том числе паспортные данные участников юридического лица и его руководителя. Она предоставляется только органам власти, судам, государственным внебюджетным фондам.

Дорогие читатели! Наши статьи рассказывают о типовых способах решения юридических вопросов, но каждый случай носит уникальный характер.

Если вы хотите узнать, как решить именно Вашу проблему — обращайтесь в форму онлайн-консультанта справа или звоните по телефонам, представленным на сайте. Это быстро и бесплатно!

Получить выписку из ЕГРЮЛ и ЕГРИП можно не посещая налоговую инспекцию

Сведения о юридических лицах и индивидуальных предпринимателях, содержащиеся в реестрах, предоставляются в виде:. Если юрлицо или ИП закрыты, эти сведения также будут отражены в выписке. Выписку из ЕГРЮЛ или ЕГРИП и справку об отсутствии сведений в реестрах можно получить онлайн, в виде электронного документа, подписанного усиленной квалифицированной электронной подписью, или на бумажном носителе.

Если вы хотите узнать сведения о юридическом лице или индивидуальном предпринимателе, вы можете воспользоваться сервисом Федеральной налоговой службы ФНС. Также вы можете найти сведения о юрлице, использовав его основной государственный регистрационный номер ОГРН или идентификационный номер налогоплательщика ИНН.

Сведения в сервисе актуализируются ежедневно. Пердоставляются бесплатно, сразу после направления запроса. Вы можете заказать выписку из ЕГРЮЛ или ЕГРИП или справку об отсутствии запрашиваемых вами сведений в реестрах в форме электронного документа, подписанного усиленной квалифицированной электронной подписью. Для этого вам нужно зарегистрироваться на сайте ФНС и воспользоваться специальным сервисом.

Электронная подпись для подачи запроса не нужна. Выписку или справку вы получите не позднее чем на следующий день после подачи запроса. Скачать электронный документ можно в течение 5 дней после получения. Документ формируется в формате pdf, содержащем усиленную квалифицированную электронную подпись и ее визуализацию. Ее видно даже после того, как вы распечатаете документ. Чтобы заказать выписку из ЕГРЮЛ или ЕГРИП на бумажном носителе или копию документа, на основании которого сведения были внесены в реестр, вам нужно составить запрос в налоговую инспекцию.

Услуга платная. Обратите внимание, если вам нужно получить копии нескольких документов из реестра, вам нужно будет оплатить каждую из них. Вы можете заранее обратиться в налоговую инспекцию, чтобы узнать, сколько и какие документы находятся в деле интересующего вас юридического лица или индивидуального предпринимателя, и заблаговременно рассчитать оплату. Вы можете узнать сведения о месте жительства индивидуального предпринимателя.

Для этого вам нужно обратиться в любой налоговый орган , предоставляющий такую информацию, с документом, удостоверяющим личность. Индивидуальный предприниматель может узнать, кто интересовался местом его жительства.

Для этого ему нужно обратиться в налоговую инспекцию по месту жительства. Это может быть однократный доступ к реестру или годовое абонентское обслуживание одного рабочего места. Подробнее об этом вы можете прочесть на сайте ФНС.

Как узнать адрес индивидуального предпринимателя. Где хранятся сведения о юридических лицах и индивидуальных предпринимателях? Как узнать адрес ИП, и узнает ли предприниматель, кто этим интересовался? Сведения о юридических лицах и индивидуальных предпринимателях, содержащиеся в реестрах, предоставляются в виде: В выписке указаны наименование организации или ФИО индивидуального предпринимателя фермера , ОГРН или ОГРНИП, ИНН, сведения о том, какой налоговой инспекцией и на основании каких документов было зарегистрировано юрлицо или ИП, какой основной и дополнительной деятельностью оно может заниматься.

Кто может обратиться за сведениями? Сведения предоставляются любому заинтересованному лицу. Как получить сведения в форме электронного документа? Как получить сведения на бумажном носителе? Запрос можно подать лично, а можно направить почтовым отправлением. А можно получить доступ к самим реестрам? Расскажите друзьям. Cмотрите также. Как получить сведения из ЕГРН.

Выписка из ЕГРЮЛ

Сведения о юридических лицах и индивидуальных предпринимателях, содержащиеся в реестрах, предоставляются в виде:. Если юрлицо или ИП закрыты, эти сведения также будут отражены в выписке. Выписку из ЕГРЮЛ или ЕГРИП и справку об отсутствии сведений в реестрах можно получить онлайн, в виде электронного документа, подписанного усиленной квалифицированной электронной подписью, или на бумажном носителе.

Для получения информации достаточно ввести ИНН организации, предпринимателя или физического лица. Выписка из реестра или справка об отсутствии сведений будет предоставлена в онлайн режиме. Обращаем внимание, что в соответствии с п.

Выписка из ЕГРЮЛ Единый государственный реестр юридических лциц предоставляется бесплатно любому юридическому лицу или физическому лицу по запросу, согласно ст. Официальный документ налоговой службы ФНС. Выгружается через интернет в форматах PDF и Excel. Документ можно скачать онлайн или получить на E-mail.

Выписка из ЕГРЮЛ — Налоговая выписка ФНС

Единый государственный реестр юридических лиц ЕГРЮЛ и Единый государственный реестр индивидуальных предпринимателей ЕГРИП — это федеральные информационные ресурсы, содержащие общие систематизированные сведения о юридических лицах и индивидуальных предпринимателях, зарегистрированных на территории РФ, а также данные об их изменениях и ликвидации. Выписка из ЕГРЮЛ налоговая требуется при таких действиях, как открытие счета в банке, нотариальное заверение документов, получение лицензии, участие в тендере, аукционе или торгах и прочих, где необходима точная, официальная, а главное актуальная информация об определенном юридическом лице. Воспользуйтесь онлайн-сервисом оформления документов , который поможет Вам бесплатно автоматически подготовить заявление на выписку из ЕГРЮЛ прямо на нашем сайте, Вам нужно лишь заполнить несколько полей и заявление готово к печати. Для этого добавьте в любое из заявлений слова «в срочном порядке» и оплатите соответствующую госпошлину. Оплаченную квитанцию подкрепляем к верхнему краю заявления степлером. C помощью данного сервиса можно также оплатить госпошлину онлайн через одного из банков-партнеров ФНС России. Услуга предоставляется бесплатно.

Выписка из ЕГРЮЛ в бумажной форме

Размер платы за вышеназванные документы определяется постановлением Правительства Российской Федерации от Любое лицо — физическое или юридическое, организация или гражданин имеют право получить выписку из реестра на любую организацию или на любого предпринимателя сделав запрос и оплатив пошлину. Выписка из единого государственного реестра юридических лиц — выписка из ЕГРЮЛ — официальный документ, который выдает регистрирующий орган Федеральная налоговая служба. Содержащиеся в государственном реестре сведения о конкретном юридическом лице или индивидуальном предпринимателе предоставляются по запросу, составленному в произвольной форме с указанием необходимых сведений согласно «Правилам ведения единого государственного реестра юридических лиц и предоставления содержащихся в нем сведений», в виде выписки из государственного реестра по форме установленной этими Правилами. Выписка из реестра скрепляется печатью органа выдавшего документ и подписью ответственного лица.

.

.

Как получить сведения из ЕГРЮЛ или ЕГРИП

.

ПОСМОТРИТЕ ВИДЕО ПО ТЕМЕ: Как получить выписку из ЕГРЮЛ для участия в тендере

.

Как получить выписку из ЕГРЮЛ

.

сервиса и иным техническим вопросам следует обращаться в службу технической поддержки. Начать работу. Контакт-центр ФНС: 8 ​

.

.

.

.

.

.

.

ВИДЕО ПО ТЕМЕ: Получить выписку из ЕГРЮЛ бесплатно самостоятельно на сайте instrument-husqvarna.ru

Справка для ФНС об оплате медицинских услуг ИНВИТРО

Информация о порядке предоставления справок об оплате медицинских услуг для представления в налоговые органы Российской Федерации


В соответствии с подпунктом 3 пункта 1 статьи 219 Налогового кодекса РФ налогоплательщик имеет право на получение социального налогового вычета в размере суммы, уплаченной им в налоговом периоде за медицинские услуги, оказанные медицинскими организациями ему, его супругу (супруге), родителям, детям (в том числе усыновленным) в возрасте до 18 лет, подопечным в возрасте до 18 лет (в соответствии с перечнем медицинских услуг, утвержденным Правительством РФ), с учетом ограничения по сумме, установленного пунктом 2 статьи 219 Налогового кодекса РФ. 

Право на применение социального налогового вычета, предусмотренного подпунктом 3 пункта 1 статьи 219 Налогового кодекса РФ, имеют все плательщики НДФЛ- получатели доходов, облагаемых по ставке 13%.

Справка об оплате медицинских услуг для представления в налоговые органы РФ выдаётся по требованию налогоплательщика, производившего оплату медицинских услуг, и оформляется бесплатно. Справка оформляется в соответствии с Приказом Минздрава РФ N 289, МНС РФ N БГ-3-04/256 от 25.07.2001.

Для получения справки необходимо предоставить документы, подтверждающие произведенные расходы (кассовые чеки, банковские выписки, квитанции, бланки строгой отчетности), и сообщить ФИО налогоплательщика, ИНН налогоплательщика (при его наличии). Срок подготовки справки – до 25 рабочих дней.

Если медицинские услуги оплачены налогоплательщиком для супруга (супруги), родителей или детей, необходимо дополнительно предоставить сведения о ФИО лица, которому были оказаны медицинские услуги, и степени родства с налогоплательщиком. В справке сведения указываются со слов налогоплательщика. В налоговый орган подается копия документа, подтверждающего степень родства (например, свидетельство о рождении, свидетельство о браке), налоговый орган вправе запросить оригинал документа.

Порядок оформления справки уточняйте у администраторов Медицинских офисов и по телефонам справочно-информационной службы 8 (495) 363-0-363 (для звонков из Москвы), 8 (800) 200-363-0 (для звонков из регионов, звонок по России бесплатный).

Внимание! Уважаемые пациенты! Справка установленного образца выдается только при наличии документов, подтверждающих произведённые расходы. Обращаем Ваше внимание, утерянные, выцветшие кассовые чеки не восстанавливаются.

Межрайонная ИФНС России № 22 по Челябинской области

15.07.2021

СРОК УПЛАТЫ НАЛОГА НА ДОХОДЫ ЗА 2020 год — НЕ ПОЗДНЕЕ 15 ИЮЛЯ 2021 года

09.07.2021

Налоговые органы Челябинской области приглашают получить квалифицированную электронную подпись бесплатно

22.06.2021

Студенты 2 курса колледжа посетили налоговую инспекцию

17.06.2021

О применении контрольно-кассовой техники при осуществлении расчетов в Российской Федерации

Возможности электронного сервиса  «Личный кабинет налогоплательщика — индивидуального предпринимателя»

Возможности сервиса на сайте ФНС России «Личный кабинет налогоплательщика — организации»

Уменьшение суммы налога, уплачиваемого в связи с применением патентной системой налогообложения (далее – ПСН), на сумму уплаченных индивидуальным предпринимателем (далее  — ИП) страховых взносов за своих работников и страховых взносов на обязательное пенсионное страхование и обязательное медицинское страхование в фиксированном размере за себя

В какой налоговый орган индивидуальный предприниматель (далее – ИП) вправе подать уведомление об уменьшении суммы налога, уплачиваемого в связи с применением патентной системой налогообложения (далее – ПСН), на сумму уплаченных страховых платежей (взносов) и пособий

16.06.2021

Перечень государственных услуг ФНС России, предоставляемых в «Многофункциональных центрах предоставления государственных и муниципальных услуг Челябинской области»

26.05.2021

Налогоплательщик в ходе рассмотрения жалобы, до принятия по ней решения, вправе представить дополнительные документы, подтверждающие его доводы

Минимальный предельный срок владения жилыми помещениями, приобретенными по договору долевого участия при продаже исчисляется с даты полной оплаты стоимости такого жилого помещения или доли (долей) в нем

19.05.2021

Образовательная акция «Всероссийский налоговый диктант»: участвуем вместе!

Налоговый орган вправе самостоятельно исчислить налог на доходы физических лиц, в случае, если налоговая декларация не представлена в установленный срок!!!

11.05.2021

С 1 мая 2021 года действуют только новые казначейские счета для уплаты налогов

С 01.01.2021 устанавливаются новые ставки по налогу на доходы физических лиц (НДФЛ)

Освобождение от уплаты налога на имущество физических лиц в отношении имущества, используемого в предпринимательской деятельности

19.04.2021

22 апреля проводится «горячая линия» по декларированию доходов, полученных в 2020 году

13.04.2021

Гражданин, признанный банкротом, может применять специальный налоговый режим «Налог на профессиональный доход»

ПРИБЛИЖАЕТСЯ СРОК ПОДАЧИ ДЕКЛАРАЦИИ О ДОХОДАХ за 2020 ГОД!!!

Возможности электронного сервиса «ЛИЧНЫЙ КАБИНЕТ НАЛОГОПЛАТЕЛЬЩИКА ДЛЯ ФИЗИЧЕСКИХ ЛИЦ» на сайте ФНС России www.nalog.ru

О порядке получения налоговых льгот по имущественным налогам

09.04.2021

13.04.2021 года проводится «горячая линия» по декларированию доходов, полученных в 2020 году

22.03.2021

Граждане до 30 апреля 2021 года должны отчитаться о доходах, полученных в 2020 году

18.03.2021

Предоставление налоговых льгот по имущественным налогам физических лиц (имущество, транспорт, земля)

16.03.2021

Пресс — релиз С 1 января 2021 года началась декларационная кампания по доходам 2020 года! 

02.03.2021

17 марта состоится Круглый стол на тему: «с 01 января 2021 года началась декларационная кампания по доходам 2020 года»

24.02.2021

Межрайонная ИФНС России № 22 по Челябинской области провела «горячую линию» по досудебному урегулированию налоговых споров

Кто может уплатить единый налоговый платеж?

19.02.2021

СРОК ПОДАЧИ УВЕДОМЛЕНИЯ О ПЕРЕХОДЕ НА УСН В СВЯЗИ С ОТМЕНОЙ ЕНВД ПРОДЛИЛИ ДО 31 МАРТА 2021 года!!!

Не забудьте представить декларацию о доходах за 2020 год!!!

Исчисление налога на доходы при получении доходов в 2020 году

Налогоплательщики до 30 апреля 2021 года должны отчитаться в Инспекцию о доходах, полученных в 2020 году

08.02.2021

«Горячая линия» 18.02.2021 г. по досудебному урегулированию налоговых споров

27.01.2021

В связи с отменой ЕНВД уведомление на УСН  можно подать не позднее 01.02.2021 года

26.01.2021

Об уплате НДФЛ, транспортного, земельного налогов и налога на имущество физических лиц с помощью единого налогового платежа

Индивидуальный предприниматель, применяющий  специальный налоговый режим «Налог на профессиональный доход», не вправе применять упрощенную систему налогообложения 

Предоставление налогоплательщикам — организациям налоговых льгот по транспортному и земельному налогам

ПОРЯДОК ОБЛОЖЕНИЯ НАЛОГОМ НА ДОХОДЫ ФИЗИЧЕСКИХ ЛИЦ ПРОЦЕНТОВ, ПОЛУЧЕННЫХ ПО ВКЛАДАМ В БАНКАХ

Межрайонная ИФНС России № 22 по Челябинской области провела «горячую линию» по порядку применению патентной системы налогообложения

Изменения по сдаче налоговой и бухгалтерской отчетности с января 2021 года

Памятка по уплате страховых взносов за себя для граждан, принявших решение зарегистрироваться в качестве индивидуального предпринимателя

РЕКВИЗИТЫ ИНСПЕКЦИИИ ДЛЯ ОПЛАТЫ ФИКСИРОВАННЫХ СТРАХОВЫХ ВЗНОСОВ

Способы предоставления декларации (форма 3-НДФЛ)

Сроки проведения камеральной налоговой проверки и возврата излишне перечисленного налога на доходы

23.12.2020

ИНФОРМАЦИЯ ДЛЯ НАЛОГОПЛАТЕЛЬЩИКОВ ОБ ОТМЕНЕ ЕНВД И ВЫБОРЕ СИСТЕМЫ НАЛОГООБЛОЖЕНИЯ С 01.01.2021г.

30.11.2020

О специальном налоговом режиме «Налог на профессиональный доход» (далее – НПД) и порядке уплаты НПД.

24.11.2020

Межрайонная ИФНС России № 22 по Челябинской области провела 18.11.2020 года «горячую линию» по уплате имущественных налогов за 2019 год

Изменения в порядке применения ККТ для отдельных категорий налогоплательщиков и утрата актуальности системы налогообложения

Как физическому лицу уплатить налог без налогового уведомления

Система налогообложения ЕНВД отменяется с 01.01.2021 г.

С 1 января 2021 года годовая бухгалтерская (финансовая) отчетность представляется в налоговые органы только в электронном виде!!!

Отсутствие на Справке о состоянии расчетов по налогам, сборам, страховым взносам, пеням, штрафам, процентам в соответствии с Приказом ФНС  России от 28 июля 2020 г. N ЕД-7-19/[email protected] подписи руководителя (заместителя руководителя)

17.11.2020

«Горячая линия» по исчислению и уплате имущественных налогов физическими лицами за 2019 год

06.11.2020

Жалобу в налоговый орган можно направить в электронном виде!

ПЕНСИОНЕР — САМОЗАНЯТЫЙ ГРАЖДАНИН!

23.09.2020

Межрайонная ИФНС России № 22 по Челябинской области провела «горячую линию» по уплате имущественных налогов за 2019 год

Что делать, если не получено налоговое уведомление?

НПД не применяется при сдаче в аренду нежилого помещения

Новая промостраница поможет разобраться в направленных физическим лицам налоговых уведомлениях

ИНН теперь можно получить в Личном кабинете налогоплательщика

Единый налоговый платеж упрощает физическим лицам уплату имущественных налогов (налог на имущество, земельный и транспортный налог)

Где можно получить сводное налоговое уведомление

ВОЗМОЖНОСТИ ЛИЧНОГО КАБИНЕТА НАЛОГОПЛАТЕЛЬЩИКА ДЛЯ ФИЗИЧЕСКИХ ЛИЦ

21.09.2020

Межрайонной ИФНС России № 22 по Челябинской области проведена «горячая линия» по переходу на иные режимы налогообложения в связи с отменой ЕНВД с 01 января 2021 года

Налоговый орган не позднее 30 дней до наступления срока платежа по налогам обязан направить налогоплательщику налоговое уведомление

Перечень государственных услуг ФНС России, предоставляемых в «Многофункциональных центрах предоставления государственных и муниципальных услуг Челябинской области»

Срок уплаты имущественных налогов за 2019 год

02.09.2020

Электронный документооборот

Федеральной налоговой службой усовершенствован порядок направления жалоб в электронном виде по ТКС !!!

Снятие с налогового учета плательщика налога на профессиональный доход (далее – НПД)

Перечень государственных услуг ФНС России, предоставляемых в «Многофункциональных центрах предоставления государственных и муниципальных услуг Челябинской области»

В личном кабинете налогоплательщика для физических лиц появились новые разделы и функции

01.08.2020

Межрайонная ИФНС России №22 по Челябинской области информирует о проведении 22 сентября 2020 года с  14:00 – 18:00  «горячей линии» по исчислению и уплате имущественных налогов (имущество, земля, транспорт) физическими лицами за 2019 год

07.08.2020

ПРЕИМУЩЕСТВА СПЕЦИАЛЬНОГО НАЛОГОВОГО РЕЖИМА «НАЛОГ НА ПРОФЕССИОНАЛЬНЫЙ ДОХОД»

29.07.2020

Как выдавать платежные документы (чек) и платить налог на профессиональный доход?

Как зарегистрироваться в качестве «самозанятого» налогоплательщика налога на профессиональный доход через мобильное приложение «Мой налог»?

Чат-бот Таксик поможет разобраться с налогами физических лиц!!!

13.07.2020

Ознакомьтесь с возможностями электронного сервиса «ЛИЧНЫЙ  КАБИНЕТ  ИНДИВИДУАЛЬНЫЕ ПРЕДПРИНИМАТЕЛИ»

Машиночитаемые бланки с двухмерным штрих — кодом для заполнения налоговой отчетности – новые технологии в сфере бумажного документооборота

Личный кабинет налогоплательщика — юридического лица

09.07.2020

СРОК УПЛАТЫ НАЛОГА НА ДОХОДЫ ЗА 2019 год — НЕ ПОЗДНЕЕ 15 ИЮЛЯ 2020 года

При продаже единственного жилья минимальный срок владения объектом недвижимого имущества для определения имущественного вычета составляет 3 года!

Об отмене ЕНВД с 01.01.2021 и переходе на иные специальные налоговые режимы

ФНС России разработала новый сервис «Налоговый калькулятор – Какой режим подходит моему бизнесу»

Воспользуйтесь шаблонами при заполнении налоговой декларации о доходах по форме 3-НДФЛ в онлайн-режиме посредством интерактивного сервиса «Личный кабинет налогоплательщика для физических лиц»

20.05.2020

Проверка права на получение субсидии субъектом МСП, ведущим деятельность в пострадавших отраслях

Проверка возможности получения отсрочки/рассрочки в связи с связи с GOVID — 19 субъектами МСП, ведущим деятельность в пострадавших отраслях

Прием в МФЦ налоговых документов по имущественным налогам физических лиц

Предоставляем декларацию о доходах в электронном виде

ПРЕДОСТАВЛЕНИЕ ЗАЯВЛЕНИЯ НА НАЛОГОВЫЕ ЛЬГОТЫ ПО ИМУЩЕСТВЕННЫМ НАЛОГАМ

Пониженные тарифы страховых взносов

Поддержка медперсоналу, малому и среднему бизнесу

О предоставлении физическим лицам, применяющим налог на профессиональный доход (далее – НПД), налоговых вычетов по налогу на доходы физических лиц

О предоставлении организациям и индивидуальным предпринимателям налоговой льготы по транспортному налогу 

Направление заявления о прекращении деятельности в качестве индивидуального предпринимателя в электронном виде!

Машиночитаемые бланки с двухмерным штрих — кодом для заполнения налоговой отчетности – новые технологии в сфере бумажного документооборота

Личный кабинет для физических лиц

«Личный кабинет налогоплательщика — юридического лица»

Ознакомьтесь с возможностями электронного сервиса «ЛИЧНЫЙ  КАБИНЕТ  ИНДИВИДУАЛЬНЫЕ ПРЕДПРИНИМАТЕЛИ» на сайте ФНС России www.nalog.ru

29.04.2020

29 апреля Вебинар Торгово-промышленной палаты и ФНС России

27.04.2020

Межрайонной ИФНС России № 22 по Челябинской области проведена «горячая линия» по доходам, полученным в 2019 году

Продление сроков представления деклараций и сроков уплаты налогов (взносов) в соответствии с Постановлением Правительства РФ №409 от 02.04.2020

16.04.2020

Декларационная кампания по доходам 2019 года!

Декларация по форме 3-НДФЛ отправляем через Личный кабинет

ФНС России рекомендует взаимодействовать с налоговыми органами в электронном виде

Порядок возврата налога на доходы физических лиц

Порядок предоставления расчетов по страховым взносам

Правительство России перенесло сроки уплаты налогов и сдачи налоговой отчетности

Декларационная кампания по доходам физических лиц полученных в 2019 году продлится до 30 июля

17.02.2020

Пресс — релиз КС изменения налогового законодательства

Основные изменения налогового законодательства с 2020 года!!!

Межрайонной ИФНС России № 22 по Челябинской области приняла участие в обсуждении нового специального налогового режима

06.02.2020

Не копите долги!!! Оплачивайте налоги вовремя!!!

10.12.2019

Налоговая отчетность по страховым взносам,  по форме 2-НДФЛ и 6-НДФЛ при условии численности работников свыше 10 человек подлежит представлению налоговым агентом в электронном виде!

ПОЛУЧИТЬ ВЫЧЕТ ТЕПЕРЬ МОЖНО ЗА ЛЮБОЕ ЛЕКАРСТВО ПО РЕЦЕПТУ ВРАЧА

22.11.2019

Федеральная Налоговая Служба утвердила для организаций форму заявления о льготах по транспортному и земельному налогах  

Собственники недвижимости и транспорта обязаны не позднее 2 декабря 2019 года уплатить имущественные налоги за 2018год!!!

О снятии с учета в качестве налогоплательщика ЕНВД, в случае приостановления деятельности

14.11.2019

Инспекция провела «горячую» линию по порядку и уплате имущественных налогов за 2018 год

За какие налоговые периоды можно уменьшить сумму исчисленного налога ЕНВД при приобретении ККТ

Внесены важные изменения в Федеральный закон от 06.12.2011 №402-ФЗ «О бухгалтерском учете»

Разобраться в налоговых уведомлениях поможет промостраница «Налоговое уведомление 2019»

Студенты 2 курса колледжа посетили налоговую инспекцию

Утверждена новая форма декларации по форме 3-НДФЛ за 2019 год

06.11.2019

«Горячая линия» по исчислению и уплате имущественных налогов (имущество, земля, транспорт) физическими лицами за 2018 год

01.11.2019

Налоговики подвели итоги «Дней открытых дверей» по информированию физических лиц по вопросам исполнения налоговых уведомлений и системы оценки качества обслуживания в территориальных налоговых органах

18.10.2019

Государственный информационный ресурс бухгалтерской (финансовой) отчетности

Внесены важные изменения в Федеральный закон от 06.12.2011 №402-ФЗ «О бухгалтерском учете»

17.10.2019

Зачем нужен Личный кабинет налогоплательщика?

ТРЕТИЙ ЭТАП ДОБРОВОЛЬНОГО ДЕКЛАРИРОВАНИЯ СЧЕТОВ И АКТИВОВ

Налоговое уведомление теперь можно получить в многофункциональных центрах 

16.10.2019

Межрайонная  ИФНС России  №22 по Челябинской области сообщает о проведении 18.10.2019 года в  10:00 час по адресу: г. Челябинск, Часовая ,6, каб. 109 «Круглого стола» на тему: «Государственный информационный ресурс бухгалтерской (финансовой) отчетности». Ждем ВАС!!!

26.09.2019

Школьникам  рассказали о налогах!

Срок уплаты имущественных налогов за 2018 год –  02.12.2019 года!

24.09.2019

Налоговая служба проводит ДНИ ОТКРЫТЫХ ДВЕРЕЙ

Срок уплаты имущественных налогов физических лиц за 2018 год  —  2 декабря 2019 года

Перечень государственных услуг, предоставляемых в соответствии с Соглашением о взаимодействии между областным государственным казенным учреждением «Многофункциональный центр предоставления государственных и муниципальных услуг Челябинской области» и Управлением Федеральной налоговой службы по Челябинской области 

19.09.2019

Что делать, если налоговое уведомление не получено?

Сервисы «Проверка ИНН, ФИО, СНИЛС работающих лиц»

Погасите задолженность по налогам!!!

Основные изменения по транспортному налогу с 2019 года

Основные изменения по земельному налогу с 2019 года

О предоставлении бухгалтерской отчетности в электронном виде

Налоговый орган не позднее 30 дней до наступления срока платежа по налогам обязан направить налогоплательщику налоговое уведомление.

Где можно получить сводное налоговое уведомление?

17.09.2019

Круглый стол 25.09.2019 года в 10:00 час по адресу: г. Челябинск, Часовая, 6, каб. 109 на тему: «Началась кампания по уплате имущественных налогов за 2018 год».  

16.09.2019

Инспекция поздравила воспитанников детского дома с Днем знаний!

29.08.2019

Выписку по сведениям из ЕГРЮЛ и ЕГРИП можно получить в электронном виде

Пользователи, в работе контрольно-кассовой техники которых произошел сбой, вправе осуществлять расчеты без применения контрольно-кассовой техники в связи с отсутствием вины.

16.08.2019

Как присваивается ИНН и используется налоговым органом

Должен ли вышестоящий налоговый орган устанавливать и применять смягчающие ответственность обстоятельства, если налогоплательщик не заявлял в жалобе о снижении размера взыскиваемого штрафа в связи с их наличием?

Внимание налогоплательщикам – физическим лицам! Срок уплаты по налогам, уплачиваемым физическими лицами за 2018 год (налог на имущество, транспортный налог, земельный налог) не позднее 02 декабря 2019 года

Уменьшение индивидуальными предпринимателями налога на суммы уплаченных страховых взносов при разных системах налогообложения 

Физические лица обязаны уведомлять налоговые органы о счетах и вкладах за пределами России 2019

21.06.2019

Перечень государственных услуг ФНС России, предоставляемых в «Многофункциональных центрах предоставления государственных и муниципальных услуг Челябинской области»

СРОК УПЛАТЫ НАЛОГА НА ДОХОДЫ ФИЗИЧЕСКИХ ЛИЦ ЗА 2018 год

Направляем налоговую, бухгалтерскую отчетность и документы по ТКС!

Плакат Встречай лето без долгов

Двухмерное штрихкодирование данных налоговой и бухгалтерской отчетности

График тематических семинаров на 3 квартал 2019 года

График работы по информированию ККТ

17.06.2019

С 2019 года налогоплательщики – физические лица могут уплачивать налог на имущество, транспортный и земельный налоги при помощи единого налогового платежа

О предоставлении сообщения о наличии объектов недвижимого имущества и (или) транспортных средств, признаваемых объектами налогообложения по соответствующим налогам, уплачиваемым физическими лицами

В отпуск без долгов!!!

13.06.2019

Межрайонная ИФНС России № 22 по Челябинской области  сообщает о проведении Федеральной налоговой службой информационной кампании – «Отпуск без долгов»

Воспитанники подшефного Детского дома отметили День защиты детей

20.05.2019

Электронный сервис «Личный кабинет для юридических лиц» на сайте www.nalog.ru

Налог на имущество с 2019 года российские организации уплачивают только в отношении недвижимого имущества

С 01 июля 2019 года перейти на новый порядок применения контрольно-кассовой техники (далее – ККТ) обязаны все налогоплательщики, которым ранее была предоставлена отсрочка применения ККТ

Социальный налоговый вычет на лечение ребенка

Сумма земельного налога для физических лиц за 2018 год может быть увеличена не более чем на 10 процентов!

06.05.2019

Межрайонной ИФНС России № 22 по Челябинской области (далее – Инспекция) 30 апреля 2019 года проведена ознакомительная экскурсия для студентов 2 курса «Южно-Уральского многопрофильного колледжа»

30.04.2019

Межрайонной ИФНС России № 22 по Челябинской области проведена «горячая линия» по доходам, полученным в 2018 году

26.04.2019

С 2019 года отменен вычет по транспортному налогу по ПЛАТОНу

О необходимости применения контрольно-кассовой техники с 01.07.2019

12.04.2019

22.04.2019г. проводится «Горячая линия» по декларированию доходов, полученных в 2018 году 

10.04.2019

СРОК УПЛАТЫ НАЛОГА НА ДОХОДЫ ФИЗИЧЕСКИХ ЛИЦ ЗА 2018 год

Дополнительные налоговые вычеты по имущественным налогам многодетным семьям

01.04.2019

В апреле налоговые инспекции Челябинской области проведут «Дни открытых дверей для граждан, декларирующих доходы» 

22.03.2019

Менять свидетельство о постановке на учет (ИНН) при изменении места жительства не надо!

Новая льгота по транспортному налогу для физических лиц

Вправе ли организация обжаловать решение налогового органа в суд, если вышестоящий налоговый орган не рассмотрел ее жалобу по причине отсутствия в ней подписи представителя организации

21.03.2019

НОВЫЙ ВИД НАЛОГОВОГО ПЛАТЕЖА ДЛЯ ФИЗИЧЕСКИХ ЛИЦ

НАЛОГ НА ПРОФЕССИОНАЛЬНЫЙ ДОХОД

Коэффициенты-дефляторы на 2019 год

Граждане не позднее 30 апреля 2019 года должны отчитаться о доходах, полученных в 2018 году

Ознакомьтесь с возможностями электронного сервиса «ЛИЧНЫЙ КАБИНЕТ ИНДИВИДУАЛЬНЫЕ ПРЕДПРИНИМАТЕЛИ» на сайте ФНС России www.nalog.ru

05.03.2019

С 01 января 2019 года началась декларационная кампания по доходам 2018 года 

УВАЖАЕМЫЕ НАЛОГОПЛАТЕЛЬЩИКИ! Налоговая служба проводит ДНИ ОТКРЫТЫХ ДВЕРЕЙ для физических лиц  по информированию о налоговом законодательстве и порядке заполнения налоговых деклараций по налогу на доходы физических лиц!

Студенты медицинского колледжа вновь посетили налоговую инспекцию!

04.03.2019

Межрайонная ИФНС России №22 по Челябинской области сообщает о проведении 07.03.2019 года круглого стола

12.02.2019

С 1 марта 2018 года по 28 февраля 2019 года можно сообщить о своих зарубежных активах и счетах в любую налоговую инспекцию или в ФНС России

Задолженность по имущественным налогам за 2017 год снижается

29.01.2019

Пост-Релиз по результатам проведения информационной кампании «Новый год без долгов»

25.01.2019

Не забудьте представить декларацию о доходах за 2018 год!!!

Способы предоставления декларации (форма 3-НДФЛ)

Заявление на льготу по имущественным налогам (имущество, транспорт, земля) носит заявительный характер

Срок подачи заявления на льготу по имущественным налогам (имущество, транспорт, земля) – 01.04.2019 года

Сроки проведения камеральной налоговой проверки и возврата излишне перечисленного налога на доходы

11.01.2019

Для физических лиц, имеющих задолженность по имущественным налогам (налог на имущество физических лиц, транспортных налог, земельный налог)!

Архив новостей

Межрайонная инспекция Федеральной налоговой службы № 4 по Республике Крым | Феодосия

Ф.И.О.

Должность

Дни и часы приема

Адрес приема

Ким
Александр Георгиевич

Начальник
Инспекции

Каждый 1-й и 3-й понедельник месяца
с 14-00 до 17-00

г.Феодосия,
ул. Крымская,82-в

Денисова
Татьяна Леонидовна

Заместитель
начальника Инспекции

Каждую 1-ю пятницу месяца
с 14-00 до 16-00

пгт.Советское,
ул. Механизаторов,1

Денисова
Татьяна Леонидовна

Заместитель
начальника Инспекции

Каждую 3-ю пятницу месяца
с 14-00 до 16-00

пгт.Кировское,
ул. Фрунзе,4

Кормилицына
Оксана Геннадиевна

Заместитель
начальника Инспекции

Каждый 1-й и 3-й четверг месяца
с 10-00 до 12-00

г.Судак,
ул.Яблоневая,10

Структурная основа уникальной сигнальной оси интерферона-β, опосредованной рецептором IFNAR1

  • 1

    Pestka, S. Интерфероны: через 50 лет после их открытия предстоит еще многое узнать. J. Biol. Chem. 282 , 20047–20051 (2007).

    CAS PubMed Google Scholar

  • 2

    Меджитов Р. Толл-подобные рецепторы и врожденный иммунитет. Nat. Rev. Immunol. 1 , 135–145 (2001).

    CAS PubMed Google Scholar

  • 3

    Barnes, B., Lubyova, B. & Pitha, P.M. О роли IRF в защите хозяев. J. Interferon Cytokine Res. 22 , 59–71 (2002).

    CAS PubMed Google Scholar

  • 4

    Gessani, S., Belardelli, F., Pecorelli, A., Puddu, P. & Baglioni, C. Бактериальный липополисахарид и гамма-интерферон индуцируют транскрипцию мРНК бета-интерферона и секрецию интерферона в мышиных макрофагах. J. Virol. 63 , 2785–2789 (1989).

    CAS PubMed PubMed Central Google Scholar

  • 5

    Hamilton, JA, Whitty, GA, Kola, I. & Hertzog, PJ. Эндогенный IFN-альфа-бета подавляет синтез ДНК макрофагов, стимулированный колониестимулирующим фактором (CSF) -1, и опосредует ингибирующие эффекты липополисахарида и TNF- альфа. J. Immunol. 156 , 2553–2557 (1996).

    CAS PubMed Google Scholar

  • 6

    Такаянаги, Х., Ким, С. и Танигучи, Т. Перекрестная передача сигналов между RANKL и интерферонами при дифференцировке остеокластов. Arthritis Res. 4 (доп. 3), S227 – S232 (2002).

    PubMed PubMed Central Google Scholar

  • 7

    Lamken, P. et al. Функциональная картография эктодомена субъединицы рецептора интерферона I типа ifnar1. J. Mol. Биол. 350 , 476–488 (2005).

    CAS PubMed Google Scholar

  • 8

    Старк, Г.Р., Керр, И.М., Уильямс, Б.Р., Сильверман, Р.Х. и Шрайбер, Р.Д. Как клетки реагируют на интерфероны. Annu. Rev. Biochem. 67 , 227–264 (1998).

    CAS PubMed PubMed Central Google Scholar

  • 9

    Thomas, C. et al. Структурная связь между дискриминацией лиганда и активацией рецептора интерферонами типа I. Cell 146 , 621–632 (2011).

    CAS PubMed PubMed Central Google Scholar

  • 10

    Платаниас, Л.К., Уддин, С. и Коламоничи, О. Фосфорилирование тирозином альфа- и бета-субъединиц рецептора интерферона типа I. Интерферон-бета избирательно индуцирует фосфорилирование тирозина белка, ассоциированного с альфа-субъединицей. J. Biol. Chem. 269 , 17761–17764 (1994).

    CAS Google Scholar

  • 11

    Deonarain, R. et al. Важнейшая роль IFN-бета в развитии лимфоидов, миелопоэзе и развитии опухолей: связь с фактором некроза опухоли альфа. Proc. Natl. Акад. Sci. США 100 , 13453–13458 (2003).

    CAS PubMed Google Scholar

  • 12

    Deonarain, R. et al. Нарушение противовирусного ответа и индукции альфа / бета-интерферона у мышей, лишенных бета-интерферона. J. Virol. 74 , 3404–3409 (2000).

    CAS PubMed PubMed Central Google Scholar

  • 13

    Томас, К.Э., Галлиган К.Л., Ньюман Р.Д., Фиш Э. И Фогель, С. Вклад интерферона-бета в ответ мышиных макрофагов на липополисахарид, агонист толл-подобного рецептора 4. J. Biol. Chem. 281 , 31119–31130 (2006).

    CAS PubMed Google Scholar

  • 14

    Чавла-Саркар, М., Лиман, Д.В. И Борден, E.C. Предпочтительная индукция апоптоза интерфероном (IFN) -beta по сравнению с IFN-alpha2: корреляция с индукцией TRAIL / Apo2L в клеточных линиях меланомы. Clin. Cancer Res. 7 , 1821–1831 (2001).

    CAS PubMed Google Scholar

  • 15

    Коэльо Л.Ф., Магно де Фрейтас Алмейда Г., Меннечет Ф.Дж., Бланги А. и Узе Г. Интерферон-альфа и -бета по-разному регулируют остеокластогенез: роль дифференциальной индукции экспрессии хемокина CXCL11. Proc. Natl. Акад. Sci. США 102 , 11917–11922 (2005).

    PubMed Google Scholar

  • 16

    Калие, Э., Jaitin, D.A., Podoplelova, Y., Piehler, J. & Schreiber, G. Стабильность тройного интерферон-рецепторного комплекса, а не сродство к отдельным субъединицам, диктует различную биологическую активность. J. Biol. Chem. 283 , 32925–32936 (2008).

    CAS Google Scholar

  • 17

    Jaks, E., Gavutis, M., Uze, G., Martal, J. & Piehler, J. Дифференциальная аффинность рецепторных субъединиц интерферонов типа I определяет активацию дифференциального сигнала. J. Mol. Биол. 366 , 525–539 (2007).

    CAS Google Scholar

  • 18

    Senda, T., Saitoh, S. & Mitsui, Y. Уточненная кристаллическая структура рекомбинантного мышиного интерферона-бета при разрешении 2,15 A. J. Mol. Биол. 253 , 187–207 (1995).

    CAS PubMed Google Scholar

  • 19

    Fenner, J.E. et al. Супрессор передачи сигналов цитокинов 1 регулирует иммунный ответ на инфекцию путем уникального ингибирования активности интерферона I типа. Nat. Иммунол. 7 , 33–39 (2006).

    CAS PubMed Google Scholar

  • 20

    Sheehan, K.C. и другие. Блокирование моноклональных антител, специфичных к субъединице 1 мышиного IFN-альфа / бета-рецептора (IFNAR-1), от мышей, иммунизированных с помощью гидродинамической трансфекции in vivo . J. Interferon Cytokine Res. 26 , 804–819 (2006).

    CAS PubMed Google Scholar

  • 21

    Гоф Д.J. et al. Функциональное взаимодействие между интерфероном I и II типа через регулируемую экспрессию STAT1. PLoS Biol. 8 , e1000361 (2010).

    PubMed PubMed Central Google Scholar

  • 22

    Zhao, W. et al. Консервативный тирозиновый мотив рецептора IFN-альфа направляет биологический ответ на IFN типа I. J. Immunol. 180 , 5483–5489 (2008).

    CAS PubMed Google Scholar

  • 23

    Фрит, М.C. et al. Обнаружение функциональных мотивов ДНК посредством статистической репрезентации. Nucleic Acids Res. 32 , 1372–1381 (2004).

    CAS PubMed PubMed Central Google Scholar

  • 24

    Wu, C., Macleod, I. & Su, A.I. BioGPS и MyGene.info: систематизация геноцентрической информации в Интернете. Nucleic Acids Res. 41 , D561 – D565 (2013).

    CAS PubMed Google Scholar

  • 25

    Маье, Т.и другие. Штамм инбредных мышей дикого происхождения SPRET / Ei устойчив к LPS и не продуцирует IFN-бета. Proc. Natl. Акад. Sci. США 103 , 2292–2297 (2006).

    CAS PubMed Google Scholar

  • 26

    Коэн Дж. Иммунопатогенез сепсиса. Nature 420 , 885–891 (2002).

    CAS Google Scholar

  • 27

    Hwang, S.Y. et al. Нулевая мутация в гене, кодирующем компонент рецептора интерферона I типа, устраняет антипролиферативные и противовирусные ответы на интерфероны альфа и бета и изменяет ответы макрофагов. Proc. Natl. Акад. Sci. США 92 , 11284–11288 (1995).

    CAS PubMed Google Scholar

  • 28

    Пиганис, Р.А. и другие. Супрессор передачи сигналов цитокинов (SOCS) 1 ингибирует передачу сигналов интерферона I типа (IFN) через ассоциированную с IFNAR1 тирозинкиназу Tyk2. J. Biol. Chem. 286 , 33811–33818 (2011).

    CAS PubMed PubMed Central Google Scholar

  • 29

    Малахова О.А. и другие. UBP43 представляет собой новый регулятор передачи сигналов интерферона, не зависящий от его активности изопептидазы ISG15. EMBO J. 25 , 2358–2367 (2006).

    CAS PubMed PubMed Central Google Scholar

  • 30

    Усачева, А.и другие. Белковый рецептор, содержащий мотив WD для активированной протеинкиназы C (RACK1), необходим для набора и активации сигнального преобразователя и активатора транскрипции 1 через рецептор интерферона типа I. J. Biol. Chem. 276 , 22948–22953 (2001).

    CAS PubMed Google Scholar

  • 31

    Baychelier, F. et al. Участие адаптера каркаса Gab2 в передаче сигналов интерферона I типа. Ячейка. Сигнал. 19 , 2080–2087 (2007).

    CAS PubMed Google Scholar

  • 32

    Гавутис, М., Якс, Э., Ламкен, П. и Пилер, Дж. Определение констант скорости двумерного взаимодействия рецепторного комплекса цитокинов. Biophys. J. 90 , 3345–3355 (2006).

    CAS PubMed PubMed Central Google Scholar

  • 33

    Карагиосов, М.и другие. Центральная роль интерферонов типа I и Tyk2 в индуцированном липополисахаридом эндотоксиновом шоке. Nat. Иммунол. 4 , 471–477 (2003).

    CAS PubMed Google Scholar

  • 34

    Falasca, L. et al. Трансглутаминаза II типа участвует в патогенезе эндотоксического шока. J. Immunol. 180 , 2616–2624 (2008).

    CAS PubMed Google Scholar

  • 35

    Бушон, А., Факкетти, Ф., Вейганд, М.А. и Колонна, М. TREM-1 усиливает воспаление и является решающим медиатором септического шока. Nature 410 , 1103–1107 (2001).

    CAS PubMed Google Scholar

  • 36

    Millen, S.H., Lewallen, D.M., Herr, A.B., Iyer, S.S. & Weiss, A.A. Идентификация и характеристика углеводных лигандов, распознаваемых токсином коклюша, с помощью микроматрицы гликанов и поверхностного плазмонного резонанса. Биохимия 49 , 5954–5967 (2010).

    CAS PubMed PubMed Central Google Scholar

  • 37

    Узе, Г., Лутфалла, Г., Банду, М.Т., Прудон, Д., Могенсен, К.Э. Поведение клонированного мышиного рецептора интерферона альфа / бета, экспрессируемого на гомоспецифическом или гетероспецифическом фоне. Proc. Natl. Акад. Sci. США 89 , 4774–4778 (1992).

    CAS PubMed Google Scholar

  • 38

    Каба, С.А., Сальседо, А.М., Вафула, П.О., Влак, Дж. М., и ван Оерс, М. Разработка бакмиды, отрицательной по хитиназе и v-катепсину, для улучшения целостности секретируемых рекомбинантных белков. J. Virol. Методы 122 , 113–118 (2004).

    CAS PubMed Google Scholar

  • 39

    Vivian, J.P. et al. Иммуноглобулиноподобный рецептор киллерных клеток 3DL1-опосредованное распознавание лейкоцитарного антигена человека B. Nature 479 , 401-405 (2011).

    CAS PubMed PubMed Central Google Scholar

  • 40

    Проект совместных вычислений, номер 4. Пакет CCP4: программы для кристаллографии белков. Acta Crystallogr. D Biol. Кристаллогр. 50 , 760–763 (1994).

  • 41

    Adams, P.D. и другие. PHENIX: создание нового программного обеспечения для автоматического определения кристаллографической структуры. Acta Crystallogr. D Biol. Кристаллогр. 58 , 1948–1954 (2002).

    PubMed PubMed Central Google Scholar

  • 42

    Маккой, А.Дж. и другие. Кристаллографическое программное обеспечение Phaser. J. Appl. Cryst. 40 , 658–674 (2007).

    CAS Google Scholar

  • 43

    Raman, S. et al. Прогнозирование структуры для CASP8 с уточнением всех атомов с помощью Rosetta. Белки 77 (доп.9. С. 89–99 (2009).

    CAS PubMed PubMed Central Google Scholar

  • 44

    Вагин, А., Тепляков, А. МОЛРЕП: автоматизированная программа для молекулярного замещения. J. Appl. Cryst. 30 , 1022–1025 (1997).

    CAS Google Scholar

  • 45

    Эмсли, П. и Коутан, К. Кут: инструменты построения моделей для молекулярной графики. Acta Crystallogr.D Biol. Кристаллогр. 60 , 2126–2132 (2004).

    PubMed PubMed Central Google Scholar

  • 46

    Blanc, E. et al. Доработка сильно неполных структур с максимальной вероятностью в BUSTER-TNT. Acta Crystallogr. D Biol. Кристаллогр. 60 , 2210–2221 (2004).

    CAS PubMed Google Scholar

  • 47

    Траяновская, С., Owczarek, C.M., Stanton, P.G. & Hertzog, P.J. Создание и характеристика рекомбинантного немодифицированного и фосфорилируемого мышиного IFN-alpha1 в метилотропных дрожжах Pichia pastoris. J. Interferon Cytokine Res. 23 , 351–358 (2003).

    CAS PubMed Google Scholar

  • 48

    Greenhill, C.J. et al. Транс-сигнализация IL-6 модулирует TLR4-зависимые воспалительные реакции через STAT3. J. Immunol. 186 , 1199–1208 (2011).

    CAS PubMed Google Scholar

  • 49

    Flicek, P. et al. Ensembl 2012. Nucleic Acids Res. 40 , D84 – D90 (2012).

    CAS PubMed Google Scholar

  • 50

    Bidwell, B.N. и другие. Замалчивание путей Irf7 в клетках рака груди способствует метастазированию в кости за счет ускользания иммунной системы. Nat.Med. 18 , 1224–1231 (2012).

    CAS PubMed Google Scholar

  • 51

    Юань, Дж. С., Рид, А., Чен, Ф. и Стюарт, К. Н. Jr. Статистический анализ данных ПЦР в реальном времени. BMC Bioinformatics 7 , 85–96 (2006).

    PubMed PubMed Central Google Scholar

  • 52

    van Boxel-Dezaire, A.H. et al. Основные различия в ответах первичных субпопуляций лейкоцитов человека на IFN-бета. J. Immunol. 185 , 5888–5899 (2010).

    CAS PubMed PubMed Central Google Scholar

  • (PDF) Микрокапсулирование рекомбинантного интерферона α-2b в микросферы поли (D, L-лактид-гликолид)

    Vivian Saez et al. Микросферы, содержащие рекомбинантный интерферон α-2b

    Biotecnología Aplicada 2008; Vol.25, No. 1

    36

    Эффективность инкапсуляции (79%) с использованием 5 мг / мл белка

    значительно различалась (p <0.01) из средних значений

    , полученных с использованием 10 и 20 мг / мл, из которых

    составили 59% и 56% соответственно. Эта тенденция в

    согласуется с предыдущими результатами, в которых повышение концентрации сывороточного альбумина человека

    отрицательно на

    влияло на эффективность инкапсуляции [38]. Принимая во внимание

    , что в некоторых экспериментах эффективность превышала 80%

    (данные не показаны), мы полагаем, что настоящая процедура

    (Рисунок 1) все еще может быть улучшена.

    Следовательно, следует рассмотреть дальнейшие эксперименты, которые также могут помочь

    в достижении этой цели, включая

    манипулирование такими параметрами, как объем

    и использование добавок (например, карбоксиметилцеллюлозы,

    маннита) во внутреннем водном растворе. фаза [38]. Фактически,

    микросфер PLGA, загруженных либо человеческим сывороточным альбумином

    , либо фактором роста нервов, смогли инкапсулировать эти белки

    , улучшая с 5 до 77%

    в первоначальных работах [38] до 95% или выше в дальнейшем.

    работ [39, 40].

    Мы также изучили влияние объема внутренней водной фазы

    на эффективность инкапсуляции IFN-α2b. Эмульгирование

    50 мкл раствора IFN-α2b позволило нам

    инкапсулировать 66 ± 1% (n = 5) исходного IFN-α2b.

    При использовании 100 мкл того же раствора IFN-α2b (20 мг

    IFN-α2b / мл) эффективность инкапсуляции снизилась с

    до 56 ± 2%. Подобные наблюдения с использованием как человеческих

    , так и бычьих сывороточных альбуминов были описаны ранее

    [38, 41].

    Загрузка интерферона

    Различные значения загрузки белка в диапазоне от 0,34

    до 1,63% были получены для различных экспериментальных серий изготовленных

    микросфер. Было обнаружено, что значения загрузки протеина pro-

    , соответствующие каждой концентрации IFN-α2b

    (5, 10 или 20 мг / мл), являются воспроизводимыми (данные не показаны). В отличие от поведения эффективности инкапсуляции

    , средняя нагрузка белка

    была выше при использовании большего количества концентрированных растворов IFN-α2b (0.65 ± 0,02% и

    1,23 ± 0,05% для 10 и 20 мг IFN-α2b / мл,

    соответственно), как показано на рисунке 4.

    Эти значения нагрузки IFN-α2b были выше, чем

    , описанные другие авторы, которые использовали аналогичные концентрации белка

    . Genta et al. инкапсулированная про-

    лидаза с использованием раствора белка 20 мг / мл и той же концентрации полимера

    (10%) и соотношения между

    и

    водной и органической фазами (1:10), как здесь

    [37] .Они получили содержание белка 0,6%, тогда как

    мы достигли в среднем 1,23 ± 0,05%. Используя нативный

    или конъюгированный с полиэтиленгликолем фактор роста эпидермиса

    , Kim et al. достигли нагрузок 0,18 и 0,21%,

    соответственно [42]. Они эмульгировали внутреннюю водную фазу

    , содержащую 10 мг белка на миллилитр. Работая с

    с аналогичной концентрацией IFN-α2b, мы смогли достичь

    в среднем 0,65%. Поскольку многие экспериментальные переменные

    сильно влияют на параметр загрузки белка, довольно сложно удовлетворительно объяснить различия между этими результатами.

    Целостность инкапсулированного IFN-α2b

    Для получения полезной системы доставки микросферы должны в значительной степени сохранять исходные свойства инкапсулированного белка

    [15]. Эксперименты по извлечению интерферона

    могут служить индикатором для оценки влияния существующих условий микрокапсулирования

    на цитокин.

    С этой целью мы сначала экстрагировали IFN-α2b из микросфер PLGA

    двумя методами: долговременной пассивной диффузией

    [35, 43] и экстракцией растворителем [18, 33, 44].

    IFN-α2b пассивная диффузия

    Многие авторы сообщили о неполном профиле высвобождения

    для нескольких белков. Они связали свои результаты

    с: i) изменениями в молекуле, такими как версия con-

    , в частично или полностью нерастворимые в воде белковые комплексы

    из-за строгости (например, воздействие большого количества воздуха -водные поверхности, механическое перемешивание)

    во время процесса инкапсуляции, который может замедлить

    или запретить высвобождение белка в направлении принимающей жидкости

    [31, 32, 45]; ii) неспецифическая адсорбция белка

    на полимер [31, 33] и iii) недостаточная деградация полимера

    в течение периода оценки [46].

    При оценке пассивной диффузии IFN-α2b из

    микросфер PLGA в течение 28 дней мы наблюдали

    , что этот цитокин следовал двухэтапному профилю высвобождения.

    Примерно 20% исходного IFN-α2b было повторно арендовано в течение первого дня (всплеск высвобождения), тогда как

    только небольшой процент IFN-α2b (5%) смог

    диффундировать в течение первого дня. остальной период (27 дней).

    Эффект всплеска, вероятно, мог быть связан с быстрой диффузией IFN-α2b, расположенного

    на поверхности сетей внутренних пор и

    межканалов, образованных испарением дихлор-

    метана и

    метана и

    межканалов. вода в процессе затвердевания микросфер катионов.

    Вторая стадия профиля высвобождения, вероятно,

    соответствует периоду типа индукции до

    начала потери массы полимера PLGA (биоэрозия) из-за

    гидролиза сложноэфирных связей, и IFN-α2b диффундирует

    как по существующим, так и по эрозионным каналам

    [47]. Фактически, анализ с помощью сканирующей электронной микроскопии

    показал, что микросферы почти не изменились

    до и после периода высвобождения (фиг. 5).На их поверхности можно было увидеть лишь незначительную эрозию

    . На

    , с другой стороны, гельпроникающая хроматография (Фиг.

    , ссылка 6) показала, что молекулярная масса деградированного полимера

    оставалась высокой (Mr до выпуска: 37 400;

    , Mr после: 19 700). Таким образом, эти высокомолекулярные полимерные фрагменты

    , вероятно, будут препятствовать положению IFN-α2b ex-

    во внешнюю жидкую фазу, и, следовательно,

    вносят значительный вклад в ограниченную диффузию воды-

    Рисунок 4.Влияние концентрации IFN-α2b во внутренней водной фазе

    на загрузку белка и эффективность инкапсуляции

    для микросфер, образованных двойной эмульсией и испарением растворителя.

    27. Dinarvand R, Moghadam SH, Moham-

    madyari-Fard L, Atyabi F. Приготовление

    биоразлагаемых микросфер и матрицы

    устройств, содержащих налтрексон. AAPS

    Pharm Sci Tech 2003; 4: E34.

    28. Матеович Т., Крижнар Б, Богатай М,

    Мрхар А.Влияние скорости перемешивания на биофармацевтические свойства

    микросфер Eudragit

    RS. J Microencapsul 2002;

    19: 29-36.

    29. Хан А., Трейси М.А., Бернштейн Х.,

    изобретателей; Alkermes Inc. Состав

    и

    способ контролируемого высвобождения металла

    катионостабилизированный интерферон. Патент США 5,

    ,

    , 711, 968, 1998.

    ,

    30. Cleland JL. Процедуры испарения растворителя

    для производства

    биоразлагаемых микросфер с контролируемым высвобождением для

    составов для терапевтических препаратов и вакцин.

    Biotechnol Prog 1998; 14: 102-7.

    31. Ким Х.К., Парк Т.Г. Микрокапсулирование

    гормона роста человека в биоразлагаемых полиэфирных микросферах

    : Pro-

    стабильность агрегации теина и неполный механизм высвобождения

    . Biotechnol Bioeng

    1999; 65: 661-7.

    32. Диван М., Парк Т.Г. Пегилирование увеличивает стабильность белка

    ces во время инкапсуляции

    в микросферы PLGA. J Control Release

    2001; 73: 233-44.

    33. Цзян Г., Ву Б.Х., Кан Ф., Сингх Дж., Де-

    Лука П.П. Оценка кинетики высвобождения белка

    , стабильности и взаимодействия белкового полимера в микросферах поли

    (D, L-лактид-гликолид), инкапсулированных лизоцимом.

    J Control Release 2002; 79: 137-45.

    34. Lu W, Park TG. Высвобождение белка из микросфер

    поли (молочно-гликолевая кислота):

    Проблемы стабильности белка. КПК J Pharm Sci

    Technol 1995; 49: 13-9.

    35. Ян Дж., Клеланд Дж. Л.. Факторы, влияющие на

    высвобождение in vitro рекомбинантного человеческого интерферона-γ

    (rhIFN-γ) из сфер PLGA micro-

    . J Pharm Sci 1997; 86: 908-14.

    36. Сингх М., Ширли Б., Баджва К., Самара

    Е, Хора М., О’Хаган Д. Контролируемое высвобождение

    рекомбинантного инсулиноподобного фактора роста

    из нового состава полилактида-

    совместно микрочастицы гликолида. J Control

    , выпуск 2001; 70: 21-8.

    37. Гента I, Перуджини П., Паванетто Ф.,

    Макулотти К., Модена Т., Касадо Б. и др.

    Биоразлагаемые микро-

    сфер, нагруженные ферментом, оценка in vitro ex vivo. J Con-

    trol Выпуск 2001; 77: 287-95.

    38. Пеан Дж. М., Венье-Жюльен М. С., Филмон

    Р., Сержент М., Фан-Тан-Луу Р., Бенуа Дж. П..

    Оптимизация выходов инкапсуляции HSA и NGF

    в микрочастицах PLGA. Int J

    Pharm 1998; 166: 105-15.

    39. Пеан Дж. М., Венье-Жюльен М. С., Бури

    Ф, Меней П., Бенуа Д., Бенуа Дж. П. Выпуск NGF

    из сфер поли (D, L-лактид-гликолид) микросферы

    . Влияние некоторых параметров инкапсуляции

    на стабильность инкапсулированного NGF.

    J Control Release 1998; 56: 175-87.

    40. Пеан Дж. М., Бури Ф. MCV-J, Меней П.,

    Пруст Дж. Э., Бенуа Дж. П.. Почему инкапсуляция PEG 400 co-

    улучшает стабильность NGF и высвобождение

    из биоразлагаемых микросфер PLGA? Pharm Res 1999; 16: 1294-9.

    41. Пистель К.Ф., Киссель Т. Влияние добавления соли на микрокапсулирование белков

    с использованием метода двойной эмульсии W / O / W.

    Дж. Microencapsul 2000; 17: 467-83.

    L o ad in g — Q (%)

    Encapsion ef fi cien cy — EE (%)

    IF N- 2b в фазе очереди (мг / мл)

    α

    0

    0,2

    0,4

    0,6

    0,8

    1

    1.2

    1,4

    0

    20

    40

    60

    80

    100

    5 10 20

    Q (%) EE (%)

    Биопереработка мезенхимальных стволовых клеток и их деривативов -Free Therapeutics

    Мезенхимальные стволовые клетки (МСК) привлекли огромный исследовательский интерес из-за их способности восстанавливать ткани и уменьшать воспаление при имплантации в поврежденное или больное место. Эти терапевтические эффекты в значительной степени объясняются накоплением секретируемых ими биомолекул (т.э., их секретом). Недавние исследования предоставили доказательства того, что аналогичные эффекты могут быть получены при использовании только фракции секретома, содержащей внеклеточные везикулы (EV). EV представляют собой клеточные мембраносвязанные везикулы, содержащие различные биомолекулы. Благодаря своему небольшому размеру и относительной мобильности они обеспечивают стабильный механизм доставки биомолекул (то есть биологических сигналов) по всему организму. Использование секретома МСК или его компонентов имеет преимущества по сравнению с имплантацией самих МСК: (i) сигналы можно биоинженерии и масштабировать до определенных доз, и (ii) неживой характер секретома позволяет эффективно хранить его. и перевезен.Однако, поскольку на состав и терапевтическое действие секретома могут влиять источник клеток, условия культивирования, методы выделения и условия хранения, существует потребность в стандартизации параметров биопроцессинга. Этот обзор посвящен ключевым параметрам в культуральной среде MSC, которые влияют на природу и функциональность секретома. Эта информация имеет отношение к разработке биопроцессов, направленных на увеличение производства продуктов, полученных из секретома, для их использования в качестве терапевтических средств.

    1. Введение

    Мезенхимальные стволовые клетки (МСК) — это неспециализированные клетки, которые можно выделить из различных тканей организма, включая костный мозг, жировую ткань, кожу, пуповинную кровь и синовиальную жидкость [1–3]. Считается, что клеточная популяция, выделенная из этих тканей, в основном содержит МСК, если она соответствует следующим минимальным критериям, определенным Международным обществом клеточной терапии: (i) популяция клеток должна быть прикрепленной к пластику; (ii) ≥95% клеточной популяции необходимо экспрессировать поверхностные антигены CD105, CD73 и CD90, и ≤2% могут экспрессировать CD45, CD34, CD14 или CD11b, CD79 α или CD19 и HLA-DR; и (iii) клетки должны быть способны дифференцироваться до костей, жиров и хрящей in vitro [4].

    МСК привлекли большой исследовательский интерес для лечения заболеваний из-за их способности восстанавливать ткани и уменьшать воспаление при имплантации в поврежденный или больной участок. В настоящее время многочисленные клинические испытания продемонстрировали безопасность и осуществимость методов имплантации МСК для восстановления тканей, а также для смягчения последствий заболеваний с помощью иммуномодуляции [5]. Однако, несмотря на умеренные успехи, остается много опасений относительно терапевтической эффективности МСК из-за высокой степени вариабельности клинических исходов [6].Совершенно очевидно, что необходимо найти методы, которые могут неизменно давать положительные результаты. Терапия МСК также сталкивается с проблемами, связанными с необходимостью иммунологического сопоставления доноров и реципиентов для минимизации возможности отторжения, а также с техническими соображениями, связанными с хранением и транспортировкой жизнеспособных клеток. Более того, во многих случаях было обнаружено очень ограниченное удержание МСК в месте повреждения. Несмотря на сообщения о терапевтических преимуществах, часто менее 1% трансплантированных МСК длительное время остаются в целевой ткани [7, 8].

    В то время как первоначально предполагалось, что эти клетки способствуют восстановлению тканей, дифференцируясь на специализированные типы клеток, необходимые для замены мертвых и поврежденных клеток, присущих этой ткани, появляется все больше свидетельств того, что большая часть наблюдаемого терапевтического эффекта связана с МСК. терапию можно объяснить биологической активностью факторов и молекул, секретируемых этими клетками. Фактически, в центре внимания многих клинических испытаний была оценка терапевтических эффектов факторов и молекул, продуцируемых мезенхимальными стволовыми клетками, а не интеграция самих клеток.Предполагается, что эти секретируемые факторы и молекулы, вместе именуемые «секретомом» МСК, активируют механизмы эндогенной репарации и иммуномодуляции [9]. Было даже предложено называть МСК лекарственными сигнальными клетками, чтобы более точно отражать их способ действия [10]. Это увеличивает возможность применения продуктов, полученных на основе МСК, в качестве терапевтических средств, а не имплантации самих клеток, что могло бы решить некоторые из ключевых проблем для клинической трансляции методов лечения на основе МСК.

    В настоящее время проводятся зарегистрированные клинические испытания для оценки эффективности внеклеточных везикул, полученных из секретома МСК, в том числе одно с участием пациентов с ишемическим инсультом (декабрь 2017 г.), второе для заживления макулярных отверстий (февраль 2018 г.) и третье с участием поддержание массы β -клеток при сахарном диабете I типа (СД1) (2014) [11]. Предыдущие исследования с использованием внеклеточных везикул, полученных из МСК, у пациентов с заболеваниями трансплантат против хозяина (GvHD) [12] и хронической болезнью почек (CKD) [13] продемонстрировали улучшение результатов и иммуносупрессивные эффекты.Исключение имплантированных клеток в этом подходе означает, что продукты могут быть биоинженерии для повышения терапевтического потенциала и улучшения контроля качества, могут быть масштабированы до определенных дозировок и имеют преимущества от снижения иммуногенности [14]. Кроме того, неживой характер секретома означает, что его можно охарактеризовать, хранить, упаковывать и транспортировать значительно легче, чем жизнеспособные клетки, что является критическим соображением для экономической жизнеспособности новых методов лечения.

    Необходимо преодолеть несколько проблем, чтобы сделать эту технологию клинически доступной и использовать секретом МСК в качестве бесклеточного терапевтического средства.Секретом МСК различается в зависимости от ткани, из которой выделены МСК, и существуют существенные различия между донорами и в ответ на различные условия культивирования [15, 16]. Хотя было проделано много работы, чтобы понять, как сами клетки изменяются в ответ на факторы окружающей среды, такие как оксигенация, механические силы и химические стимулы, гораздо меньше работы было сосредоточено на влиянии этих факторов на результирующие профили секретома. Такие исследования не только позволят оптимизацию секретома для конкретных приложений, но и обеспечат важную основу для крупномасштабного производства.Хотя изучение МСК в статических однослойных культурах является простым и экономичным, такие условия не способствуют крупномасштабному производству. В этом обзоре описаны терапевтические продукты, которые можно получить из МСК, и важные параметры культуры, которые необходимо учитывать для масштабируемого производства и клинической трансляции секретома МСК.

    2. Состав секретома МСК

    Секретом МСК содержит множество клеточных сигнальных молекул, включая факторы роста и цитокины, которые модулируют поведение клеток, такое как пролиферация, дифференцировка и образование внеклеточного матрикса, или обеспечивают про- и противовоспалительные эффекты.Недавние исследования предоставили доказательства того, что МСК также секретируют небольшие мембраносвязанные внеклеточные везикулы (EV), которые содержат ряд биомолекул, включая не только факторы роста и цитокины, но также различные формы РНК, способные запускать различные биологические реакции во всем организме [ 17]. Примечательно, что недавно появилось сообщение о том, что только ЭВ могут оказывать аналогичное или усиленное терапевтическое действие по сравнению с их клеточными аналогами [18].

    Во время периода культивирования секретом MSC может быть восстановлен из израсходованной среды.Термин «кондиционированная среда» (CM) используется для описания израсходованной среды или комбинации свежей среды и израсходованной среды из предшествующих клеточных культур. CM в первую очередь готовится центрифугированием израсходованной среды для удаления клеточного дебриса и последующим использованием полученного супернатанта напрямую или путем добавления его концентрированной или фракционированной формы в свежую среду. Путем фракционирования CM можно соотнести определенное молекулярное подмножество с определенным измеренным эффектом. Исследования, охватывающие широкий спектр физиологических применений, продемонстрировали преимущества секретома МСК за счет использования КМ.В таблице 1 представлены биологические эффекты, выявленные секретомом МСК или продуктами, производными от секретома МСК, на различных моделях заболевания.

    MSC974 плода человека
    SD костный мозг Сверхоксичный костный мозг крысы Костный мозг человека из ишемических условий культивирования МСК 90 974 [134] по сравнению с экзогенными средами Усиление миогенеза и ангиогенеза in vitro
    (ii) Экзосомы способствовали регенерации мышц на модели мышечного повреждения у мышей [28] .

    Источник МСК Паракринные факторы Биологическое действие Арт.

    Кожные раны и облучение
    Жировая ткань человека Супернатант клеточного лизата (i) Более быстрое закрытие раны при местном применении на кожные раны, фибробластика
    (ii) Повышение уровня фибробластов кожи миграция и образование ECM
    [25]
    Жировая ткань человека Гипоксическая кондиционированная среда (i) Защищенные эпителиальные, эндотелиальные и миоэпителиальные клетки от радиационного повреждения и ремоделирования ткани [92]
    80 [92]
    80 Жировая ткань Экзосомы (i) Стимулированная миграция, пролиферация и синтез коллагена фибробластов
    (ii) Привлечение к ранению мягких тканей в модели разреза кожи мыши и ускоренное заживление кожной раны
    [137]
    Человек и мышь костный мозг Экзосомы и микровезикулы (i) Смягчающая радиационная повреждение стволовых клеток костного мозга
    (ii) Восстановление приживления стволовых клеток костного мозга и частичное восстановление показателей периферической крови после облучения
    [41]
    Амниотические эпителиальные клетки человека Экзосомы (i) Стимулирование миграции и пролиферации фибробласты
    (ii) Частичное отложение ECM
    (iii) В модели на крысах улучшенное заживление кожных ран с помощью хорошо организованных коллагеновых волокон
    [138]
    Пуповинная кровь человека Экзосомы (i) Стимулируемые миграция клеток и синтез коллагена фибробластов кожи человека
    (ii) Повышенная экспрессия коллагена I и эластина на коже человека через 3 дня после лечения
    [139]

    Кости и хрящ
    Кондиционированная среда (i) Повышенная экспрессия ALP и генов остеогенных маркеров и повышенная отложения кальция в BM-MSC крыс
    (ii) Улучшенная консолидация костей в модели остеогенеза у крыс
    [26]
    Синовиальная мембрана человека Экзосомы (i) Усиливают пролиферацию и антиапоптотические способности стромальных структур костного мозга клетки
    (ii) Предотвращение GC-индуцированной потери трабекулярной кости, некроза костного мозга и накопления жировых клеток в модели крысы
    [140]
    Человеческий эмбрион Экзосомы (i) Улучшенный внешний вид и гистологические оценки костно-хрящевые дефекты у взрослых крыс с полным восстановлением хряща и субхондральной кости [141]
    Костный мозг человека Экзосомы по сравнению с кондиционированной средой без экзосом (i) Экзосомы, но не без экзосом кондиционированной среды, спасено замедление заживления перелома у CD9 — / — мышей [31]
    ИПС-МСК человека Экзосомы (i) В модели остеонекроза у крыс экзосомы предотвращали потерю костной массы и увеличивали плотность микрососудов
    (ii) Повышение способности эндотелиальных клеток к пролиферации, миграции и трубкообразованию in vitro
    [142]
    Кость человека костный мозг Экзосомы, miR-21 (i) Подавленный TNF- α -индуцированный апоптоз клеток пульпозного ядра [46]

    Почки
    Кондиционированные среды по сравнению с МСК (i) В модели острого повреждения почек МСК и их КМ в равной степени улучшали ухудшение функции почек, выделение Kim-1 с мочой, повреждение почечной ткани и апоптоз канальцевых клеток
    (ii) Оба уменьшали интерстициальный фиброз
    [27]
    Костный мозг Кондиционированная среда, МСК и микровезикулы (i) Облегчение индуцированного острого повреждения почек в r с небольшими различиями в эффективности между КМ, микровезикулами и МСК [143]

    Сахарный диабет
    Костный мозг мышей miR-106b-5p, mipR-106b-5p, mipR (i) Стимулирование пролиферации β -клеток после травмы
    (ii) Улучшение гипергликемии у мышей, получавших STZ
    [47]
    Жировая ткань человека Кондиционированная среда по сравнению с МСК (i) Перевернутая механическая термическая аллодиния и термическая гипералгезия
    (ii) Восстановлен правильный баланс про / противовоспалительных цитокинов и предотвращена потеря кожной иннервации
    (iii) Восстановлен баланс Th2 / Th3 в селезенках мышей, получавших STZ
    (iv) Восстановлена ​​морфология почек
    [ 144]
    Костный мозг человека Внеклеточные везикулы (i) Предотвращение начала СД1 и экспериментального аутоиммунного увеоретинита на мышиной модели
    (ii) Подавление активации антигенпрезентирующих клеток и подавление развития клеток Th2 и Th27
    [145]

    Сердечно-сосудистая система
    МСК эмбриона человека Экзосомы Уменьшение размера инфаркта на мышиной модели ишемии / реперфузионного повреждения миокарда [39]
    SD крысиный костный мозг Экзосомы по сравнению с МСК (i) Экзосомы уменьшали воспаление, подавляли фиброз и улучшали сердечную функцию у крыс Модель инфаркта миокарда (значительно превосходит МСК)
    (ii) Экзосомы стимулировали пролиферацию клеток H9C2 кардиомиоцитов, ингибировали апоптоз и ингибировали дифференцировку фибробластов в миофибробласты
    [18]
    SD крысы с повышенной экспрессией костного мозга (i) Подавление апоптоза, вызванного гипоксией, и запуск сокращения кардиомиоцитов взрослых крыс
    (ii) Повышающая регуляция VEGF, FGF-2, HGF, IGF-1 и TB4 в Akt-MSC
    [146]
    Костный мозг человека Кондиционированная среда — продукты> 1000 кДа ( 100–220 нм) (i) Кардиопротекция на мышиной модели ишемии и реперфузионного повреждения с 60% уменьшением размера инфаркта
    (ii) Снижение ядерного окислительного стресса миокарда
    (iii) Снижение передачи сигналов TGF- β и апоптоза
    (iv) Улучшение систолической и диастолической сердечной деятельности
    [38]
    huES9.E1 Экзосомы (i) Облегчение признаков реперфузионного повреждения
    (ii) Сохранение геометрии левого желудочка и сократительной способности
    (iii) Повышенные уровни АТФ и НАДН и снижение окислительного стресса
    (iv) Уменьшение местного и системного воспаления
    (v) Уменьшение размера инфаркта на 45%
    [34]
    Мышиный костный мозг Экзосомы, обогащенные miR-22 из ишемически подготовленных МСК (i) Уменьшение сердечного фиброза при инфаркте миокарда у мыши, модель
    ) Мобилизованы в кардиомиоциты, где они уменьшили апоптоз из-за ишемии
    [91]
    Пуповина человека Экзосомы (i) Улучшение сердечной систолической функции и снижение сердечного фиброза после рассмотрения коронарной артерии
    . (ii) Защищенные клетки миокарда от апоптоза и стимулирование образования трубок
    [147]
    SD костный мозг крысы ряд Экзосомы из МСК со сверхэкспрессией GATA-4, miR-19a (i) Восстановление сердечной сократительной функции и уменьшение размера инфаркта после перевязки коронарной артерии в сердце крысы
    (ii) Повышение выживаемости кардиомиоцитов и сохранение потенциала митохондриальной мембраны
    [148]
    Мышиный костный мозг Внеклеточные везикулы, miR-210 (i) Улучшение ангиогенеза и терапевтический эффект на инфаркт миокарда на мышиной модели
    (ii) miR-210, необходимый для проангиогенного эффекта
    [45]
    SD крысиный костный мозг Экзосомы (i) Повышенное образование трубки эндотелиальных клеток пупочной вены человека
    (ii) Нарушение функции Т-клеток из-за ингибирования пролиферации in vitro
    (iii) Уменьшение размера инфаркта, сохранено систолические и диастолические показатели сердца и повышенная плотность новых капилляров на модели инфаркта миокарда у крыс
    [149]
    SD костный мозг крысы Экзосомы (i) Сниженный H 2 O 2 -индуцированная продукция ROS и клеточный апоптоз кардиомиоцитов H9C2 крысы [150]
    (i) Индуцированный ангиогенез посредством пути NF κ B в HUVECs [88]
    Human Wharton jelly Microvesicles (i) Повышенная выживаемость и ишемия почек -реперфузионное повреждение после сердечной смерти
    (ii) Снижение количества макрофагов CD68 + в почках
    (iii) Снижение уровней белка α -SMA и TGF- β 1 и повышение уровней HGF
    [151]
    Костный мозг мыши Внеклеточные пузырьки (i) Повышенная реперфузия крови и образование новых кровеносных сосудов в модели ишемии задних конечностей

    Рак
    Линия клеток эмбриональной почки человека 293 GE11-положительные экзосомы, содержащие miR-let-7a (i) Подавление роста опухоли и развития опухоли мыши
    (ii) Доставка miRNA в EGFR-экспрессирующий ксенотрансплантат ткань рака молочной железы
    [152]

    Повреждение мышц
    Костный мозг человека Кондиционированные среды [30]
    Жировая ткань человека Внеклеточные везикулы (i) Модулируемые противовоспалительные эффекты, вызывающие поляризацию макрофагов
    (ii) Смягчение воспалительной среды в поврежденных тканях при CTX-повреждении TA-мышцы мыши
    (iii) Accelerat процесс регенерации мышц
    [89]

    Иммуномодулирующий
    Пуповинная кровь человека Микровезикулы (i) Снижение иммуномодулирующего эффекта + клеток [83]
    Костный мозг человека Кондиционированная среда, PGE2 (i) CM из сфероидов ингибировала LPS-стимулированные макрофаги, секретирующие провоспалительные цитокины, и увеличивала выработку ими противовоспалительных цитокинов
    [28]

    CNS
    Человеческий костный мозг Экзосомы (i) Повышение выживаемости ганглиозных клеток сетчатки (RGC) и регенерация их аксонов
    (ii) Частичное предотвращение потери аксонов
    dys. [153]
    Костный мозг человека Экзосомы из h ипоксические МСК (i) Интравитреальная обработка экзосом на мышиной модели с кислород-индуцированной ретинопатией частично сохранила сосудистый кровоток в сетчатке in vivo и уменьшила истончение сетчатки [154]
    Костный мозг Экзосомы DM (i) крысы, лечение инсульта через 3 дня после инсульта улучшило функциональный исход и уменьшило утечку гематоэнцефалического барьера и кровотечение
    (ii) Повышение плотности аксонов и миелина и количество клеток-предшественников олигодендроцитов и олигодендроцитов
    (iii) Повышение экспрессии ABCA1 и IGFR1
    [155]
    Жировая ткань человека Кондиционированная среда (i) Защищенные нейроноподобные клетки SH-SY5Y против H 2 O 2 -индуцированная нейротоксичность
    (ii) Способствует восстановлению нормальной морфологии аксонов, электрофизиологических свойств и жизнеспособность клеток
    [156]
    SD костный мозг крысы Внеклеточные везикулы 909 79 (i) Способствует функциональному восстановлению и регенерации поврежденных раздавливанием седалищных нервов у крыс [157]
    Костный мозг крысы Wistar Кондиционированная среда (i) Повышенное функциональное восстановление двигательной функции, повышенная сохранность спинного мозга ткани, усиление экспрессии GAP-43 и ослабление воспаления после повреждения спинного мозга на модели крысы [158]

    Легочный
    Костный мозг Экзосомы лейкоцитов и нейтрофилов в жидкость бронхоальвеолярного лаважа у мышей, поврежденных эндотоксином [94]
    Человеческий костный мозг Микровезикулы (i) Уменьшение симптомов идиопатического легочного фиброза, таких как уменьшение отложения коллагена у мышей и воспаление модель фиброза [159]
    Human Wharton jelly, костный мозг Ex осомы (i) Улучшение альвеолярного упрощения, фиброза и ремоделирования легочных сосудов в модели мышей, подвергшейся гипероксии
    (ii) Подавление провоспалительного состояния макрофага M1 и усиление противовоспалительного состояния M2
    [160]
    SD ra костный мозг Микровезикулы (i) Облегчение ЛАГ на модели крысы за счет регулирования системы ангиотензина
    (ii) Снижение давления в легочной артерии, толщины стенки легочного сосуда и площади просвета, гипертрофии правого желудочка, воспаления и объема коллагеновых волокон
    [161]

    Печень
    Пуповина человека Экзосомы (i) Уменьшение поверхностных фиброзных капсул и облегчение воспаления печени и отложения коллагеновых фиброзных волокон в печени 9097-мышиной модели [162]

    2 .1. Цитокины и факторы роста
    МСК

    секретируют большое количество клеточных сигнальных цитокинов и факторов роста. Эти биоактивные молекулы могут стимулировать эндогенные популяции клеток к ответам, которые могут способствовать заживлению различных тканей. Некоторые из наиболее физиологически релевантных биомолекул, секретируемых МСК, включают фактор роста гепатоцитов (HGF), который, как сообщается, участвует в иммуномодуляции, миграции клеток, развитии, заживлении ран и антиапоптозе; трансформирующий фактор роста — (TGF-) β , усиливающий иммуномодуляцию, рост, пролиферацию и дифференцировку клеток и заживление ран; фактор роста эндотелия сосудов (VEGF), играющий большую роль в ангиогенезе, но также в иммуномодуляции и выживании клеток; и такие молекулы, как ген, стимулированный фактором некроза опухолей (TSG-) 6, простагландин E2 (PGE2) и галектины 1 и 9, которые, как сообщается, играют большую роль в иммуномодуляции [19, 20].Для более подробного изучения см. Подробный обзор Bai et al. . [19], который описывает функцию биоактивных молекул, секретируемых МСК пуповины.

    Различные клинические испытания вводили отдельные биомолекулярные виды с целью вызвать положительный терапевтический ответ [21–23]. Введение фактора роста эндотелия сосудов (VEGF) было эффективным в улучшении ангиогенеза у пациентов с ишемической болезнью сердца; однако такие испытания не смогли сопоставить терапевтическую эффективность МСК [24].Точно так же высокие дозы болюсного интерлейкина-2 (ИЛ-2) одобрены FDA для лечения метастатической меланомы и почечно-клеточной карциномы, но на него не распространяются низкие показатели ответа и общеизвестная токсичность [23].

    CM, полученный из культур МСК, показал многообещающие преимущества в широком диапазоне терапевтических и иммуномодулирующих применений, включая лечение кожных ран, дистракционный остеогенез и повреждение почек [25–28]. Несмотря на широкий спектр биоактивных молекул, высвобождаемых МСК, их использование в качестве терапевтических средств ограничено их стабильностью.В физиологических условиях функциональная стабильность цитокинов и факторов роста может снизиться в течение нескольких минут [29]. Было показано, что многие из этих же биоактивных молекул также могут быть обнаружены в ЭВ, секретируемых МСК, хотя и в гораздо меньших количествах [30, 31]. Примечательно, что было продемонстрировано, что EVs, но не обедненные EV CM, могут вызывать терапевтические преимущества, такие как восстановление замедления заживления переломов на модели мышей CD9 — / — [31]. Это говорит о том, что биоактивность, которой обладают ЭВ, может дать клиническую ценность таким секретируемым структурам.

    2.2. Внеклеточные везикулы

    EV представляют собой фосфолипидные мембраносвязанные частицы, секретируемые клетками, которые содержат биологические материалы, включая ДНК, РНК, биоактивные липиды и белки. Внутренние компоненты, или «груз», специфичны для источника клеток (т.е. индивидуума, а также конкретной ткани, из которой были получены МСК) и патологического состояния клеток. ЭМ могут быть нацелены на местные клетки или транспортированы к клеткам в отдаленных тканях через биологические жидкости.После связывания с реципиентными клетками EV могут оставаться стабильно связанными с плазматической мембраной, диссоциировать, непосредственно сливаться с мембраной или интернализоваться через эндоцитарные пути [32]. ЭВ обеспечивают преимущества стабильной системы доставки, хорошо переносимой в биологических жидкостях, способности удерживаться в клетках или тканях-мишенях и, как полагают, обладают незначительной иммуногенностью in vivo [33]. Важность системы доставки EV была продемонстрирована, когда интактные, но не лизированные, EV увеличивали жизнеспособность миокарда на модели ишемии / реперфузии миокарда у мышей [34].Некоторые исследования продемонстрировали иммуносупрессивное поведение, которое может быть следствием растворимого или поверхностно экспрессируемого HLA-G, что подробно рассмотрено Ребманном и др. . [35].

    EV — это общий термин для различных типов везикул, секретируемых МСК: экзосомы, микровезикулы (также называемые эктосомами) и апоптотические тельца. Исследования терапевтической ценности ЭВ в настоящее время сосредоточены в первую очередь на экзосомах и микровезикулах. Каждый тип пузырька характеризуется своим происхождением, размером и уникальными идентификационными маркерами (рис. 1).Термин EV был рекомендован в качестве всеобъемлющего термина Международным обществом внеклеточных пузырьков (ISEV), поскольку обычно используемые методы выделения каждого отдельного типа EV не могут исключительно отделить один от другого [36].


    Большинство исследований электромобилей сосредоточено на фракции, богатой экзосомами. Экзосомы были описаны как относительно однородная популяция с точки зрения размера и лучше всего охарактеризованы среди всех ЭВ [37]. Первые исследования Тиммерса и др. . [38] предоставил доказательства того, что происходящие из МСК CM могут оказывать терапевтическое действие без использования клеток. Различные фракции кондиционированной среды вводили мышам, моделирующим ишемию сердца и реперфузионное повреждение, где было определено, что CM-содержащие продукты более 1000 кДа эффективны для кардиозащиты и уменьшения размера инфаркта. Этот диапазон размеров предполагает участие экзосом, которые были изолированы и успешно протестированы в последующем исследовании [39]. В ряде исследований сравнивались такие богатые экзосомами фракции с CM и описывались сопоставимые результаты, что дополнительно указывает на то, что экзосомы могут быть ответственны за терапевтические эффекты MSC-производных CM [18, 30, 31].Совсем недавно экзосомы сравнивали с микровезикулами с разными результатами. В модели острого повреждения почек только фракция, обогащенная экзосомами, вызывала улучшение функции и морфологии почек [40], в то время как лучший препарат для уменьшения радиационного повреждения стволовых клеток костного мозга включал оба типа ЭВ [41]. Тем не менее, полезные свойства ЭВ объясняются не только их стабильной доставкой цитокинов и факторов роста, но и заключенными в них РНК, которые играют большую роль в регуляции экспрессии генов для контроля функции клеток [30, 31, 42].

    2.3. Кодирующие и некодирующие РНК

    МСК секретируют кодирующие белки информационные РНК (мРНК) и некодирующие РНК, такие как микроРНК (miRNA), длинные некодирующие РНК (lncRNA) и кольцевые РНК (circRNA) через свои внеклеточные везикулы (EV). Такие компоненты потенциально способны вызывать изменения в функции посредством трансляции белка или изменения экспрессии генов в реципиентных клетках. Недавние разработки в области секвенирования РНК и методов RT-qPCR позволили обнаруживать РНК даже в небольших количествах [42].Кроме того, доказательства того, что мРНК, находящиеся в EV, могут транспортироваться в реципиентную клетку, а затем транслироваться, чтобы вносить вклад в экспрессию белка, оказали большое влияние на эту область. Например, клетки почечных канальцев, лишенные экспрессии IL-10, подвергшиеся действию MSC-производных EV, приобретали мРНК IL-10 и транслировали ее в соответствующий белок [43].

    miRNA представляют собой небольшие некодирующие, высококонсервативные, одноцепочечные РНК, которые выполняют функцию подавления РНК, но также способны регулировать экспрессию генов посредством посттранскрипционных модификаций.miRNA обычно разлагаются быстрее, чем mRNA. Однако они могут стать более стабильными за счет связывания с РНК-связывающими белками (RBP) или липопротеинами высокой и низкой плотности или посредством инкапсуляции EV [42]. miRNAs, как было показано, связаны с широким спектром биологических процессов, включая апоптоз клеток, дифференцировку стволовых клеток, развитие сердечных и скелетных мышц, гематопоэз, нейрогенез, секрецию инсулина и иммунный ответ [44–47]. Имея такое значение для физиологии, дисфункция miRNA может быть связана с заболеванием [48], и, следовательно, она интенсивно изучается как диагностический и прогностический биомаркер.

    LncRNA и circRNA — это еще два подмножества малых РНК, заключенных в EV. LncRNA участвуют в клеточных процессах, таких как хроматическая организация, транскрипция генов, оборот мРНК, трансляция белков и сборка макромолекулярных комплексов [42]. Они были идентифицированы в EVs с разными паттернами экспрессии по сравнению с их родительскими клетками и представляют специфические мотивы, которые, по-видимому, дополняют мотивы определенных miRNAs [42]. Таким образом, было высказано предположение, что lncRNAs могут захватывать подмножества miRNA и нацеливать их на EV.circRNA очень распространены с длительным периодом полураспада из-за отсутствия свободных концов, которые предотвращают деградацию экзонуклеазами. Такие circRNAs могут способствовать критическим транскрипционным и посттранскрипционным модификациям и контролировать функцию miRNA в качестве регуляторов стабильности и / или трансляции мРНК [42].

    3. Разработка биопроцессов для продуктов, производных секретомов

    Чтобы правильно охарактеризовать и оценить терапевтический потенциал секретома MSC и связанных с ним EV, существует требование стандартизации протоколов для размножения культур MSC, сбора секретома и изоляция определенных компонентов.Для удовлетворения клинических потребностей в продуктах, полученных из секретома МСК, изолированные популяции МСК должны быть увеличены до in vitro с использованием определенных условий культивирования, которые являются воспроизводимыми, масштабируемыми и хорошо контролируемыми, чтобы ограничить гетерогенность и повысить предсказуемость состава и функции секретома. производные продукты. Были разработаны методы увеличения популяций этих клеток [49], но они не принимали во внимание их влияние на секретом — в настоящее время эта область приобретает все большее значение, особенно с точки зрения терапевтической эффективности.

    Ключевые факторы в развитии системы производства на основе клеток включают среду, в которой выращиваются клетки, источник клеток и условия культивирования (рис. 2). Также актуальны время и метод сбора секретома, поскольку секретом очень динамичен [16]. Также важно оценивать и разрабатывать протоколы для хранения, транспортировки и доставки продуктов, полученных из секретома, чтобы исследователи могли должным образом сравнивать и воспроизводить исследования и способствовать развитию методов лечения и лекарств, использующих секретом MSC.В настоящее время не существует надежного теста для проверки целостности мембраны EV, который мог бы повлиять на терапевтический эффект EV и / или уровень воспроизводимости после введения [50]. Также не существует стандартного списка биомолекул или РНК для количественной оценки, что привело к целому ряду исследований, в которых отбирались их собственные молекулы, представляющие интерес, при игнорировании других. Более того, существует потребность в изучении активных молекул, которые могут быть онкогенными, поскольку секретом МСК содержит белки и РНК, способные изменять геном реципиентных клеток [50].Несмотря на то, что МСК продемонстрировали терапевтический эффект при лечении различных видов рака, есть доказательства того, что определенные фенотипы МСК могут способствовать прогрессированию опухоли и метастазированию [51, 52]. Специфические механизмы перекрестного взаимодействия между МСК и раковыми клетками в настоящее время плохо изучены, и, таким образом, онкогенный потенциал МСК и секретома МСК остается спорным [51, 52].


    3.1. Культуральная среда

    Четко определенная культуральная среда имеет решающее значение для трансляции продуктов, полученных из секретома МСК, в клинику.Для характеристики и анализа секретома требуется полное понимание того, что уже содержится в среде. Большинство исследований, посвященных культивированию МСК, сообщают об использовании фетальной телячьей сыворотки (FBS) в среде из-за относительно низкого уровня антител и большого количества факторов роста, которые она содержит [53, 54]. Однако состав FBS сильно варьируется в зависимости от того, где, когда и как он был собран, а также может быть заражен инфекционными агентами животного происхождения [55].Более того, когда человеческие МСК культивируются в среде, содержащей животные белки, белки удерживаются внутри клеток и могут вызывать иммунологический ответ при трансплантации клеток или клеточных продуктов [53, 56]. Сыворотка также содержит свои собственные экзосомы, которые необходимо сначала удалить в исследованиях на основе экзосом и ЭВ, чтобы предотвратить совместную изоляцию с экзосомами, полученными из МСК [57].

    Альтернативы FBS включают добавление лизата тромбоцитов человека (HPL) в среды и различные химически определенные бессывороточные среды (SFM).По сравнению с FBS, HPL снижает иммунологические реакции и усиливает пролиферацию МСК [57]. HPL имеет высокое содержание фибриногена, что способствует образованию фибриновых гелей в кальцийсодержащих средах, хотя этот эффект можно уменьшить, используя недавно разработанный метод истощения фибриногена [57]. Хотя HPL может представлять собой рентабельную альтернативу FBS для экспансии MSC, сообщалось, что MSCs, расширенные HPL, проявляли сильно ослабленные иммуносупрессивные свойства [58]; Таким образом, важно полностью проанализировать его влияние на терапевтические свойства МСК.

    Для распространения МСК человека (hMSC) было разработано большое количество SFM с определенным химическим составом, которые являются более перспективными, хотя и по более высокой цене. По сравнению с МСК, размноженными в среде, содержащей сыворотку, определенная природа SFM ограничивает гетерогенность между партиями клеток и усиливает пролиферацию МСК, генерируя клетки меньшего диаметра со стабильной экспрессией поверхностных маркеров [58, 60]. Разница в терапевтических преимуществах продуктов, полученных из секретома из клеток, выращенных в бессывороточных препаратах, по сравнению с FBS все еще требует изучения.Коммерчески доступные бессывороточные среды, которые, как было показано, успешно размножают культуры hMSC, включают StemPro MSC SFM (Invitrogen), MesenCult-SF / XF (Stemcell Technologies) и Becton Dickinson Mosaic hMSC SFM [53, 59, 60]. Из коммерчески доступных SFM StemPro MSC SFM является единственной бессывороточной лекарственной формой, одобренной FDA [61]. Кроме того, многие исследовательские лаборатории разработали собственные среды, не содержащие ксено или сыворотку. PPRF-msc6 — это бессывороточная среда, разработанная нашей лабораторной группой с опубликованным списком компонентов для поощрения дальнейших исследований и стандартизации [62].

    3.2. Cell Source

    MSC определены очень широко. По этой причине популяции клеток, которые придерживаются этого определения, все еще могут отличаться друг от друга. Эта вариабельность может быть очевидна при сравнении популяций МСК, полученных от разных индивидуумов или даже из разных тканей индивидуума. МСК также различаются по функциям в зависимости от ткани, из которой они изолированы в организме, демонстрируя различные профили секретома, специфичные для их нативной ткани. Кроме того, МСК могут быть сконструированы с помощью генной инженерии для усиления терапевтического эффекта производных от них продуктов, как подробно описано Hodgkinson et al . [63]. Будет важно сопоставить характеристики донора и источник ткани с функциональностью секретома в конкретных моделях заболевания.

    3.2.1. Изменчивость от донора к донору

    Хорошо известно, что существует внутренняя изменчивость между МСК, полученными от разных доноров / пациентов, связанная с такими факторами, как возраст и здоровье человека [64]. Например, Heathman et al. [65] показали существенные различия в потреблении и производстве метаболитов, характеристиках роста и иммунорегуляторной способности in vivo между пятью различными линиями МСК костного мозга.Аналогичным образом Paladino et al. [66] описали уникальное поведение МСК, полученных из желе Wharton, полученных от разных людей, демонстрирующих разные цитокиновые профили и иммуномодулирующие способности. Было обнаружено, что фенотип, возраст донора и пол являются факторами, влияющими на функцию МСК [67].

    Метаболическое состояние человека — еще один важный фактор, влияющий на МСК и продукты, производные от них, причем экзосомы, в частности, связаны с перекрестными помехами между органами метаболизма [68].Между полученными из жировой ткани МСК от худых и страдающих ожирением пациентов были обнаружены различные паттерны экспрессии маркеров стволовых клеток и различные уровни экспрессии днРНК в экзосомах [69]. Кроме того, было обнаружено, что ожирение снижает проангиогенный потенциал жировых MSC-производных EV, показывая пониженные количества VEGF, MMP-2 и miR-126 в составе EV [70]. Интересно, что было обнаружено, что МСК, полученные от пациентов с сахарным диабетом 2 типа (СД2), не проявляют различий в фенотипе маркеров клеточной поверхности, морфологии или многолинейном потенциале по сравнению со здоровыми людьми, но имеют пониженную активность, дисфункции, зависимые от окислительного стресса и дисфункциональный состав секретома, усиливающий проангиогенную функцию [71].

    При сравнении МСК, полученных от здоровых людей, с МСК из болезненных состояний, неудивительно, что МСК из болезненных состояний демонстрируют сниженную функцию. Например, по сравнению со здоровым контролем, CM, полученный из культур MSC с использованием клеток, полученных от пациентов с рассеянным склерозом (MS), устранял нейропротекторный эффект MSC-CM при использовании в модели прогрессирующего MS [72]. В некоторых случаях, например, в МСК, полученных от пациентов с СД1, МСК не обнаруживают различий с точки зрения морфологии, иммуносупрессивной активности и способности миграции, но имеют различия в экспрессии генов, которые могли повлиять на их функцию in vivo [71] .Механизмы, с помощью которых характеристики донора, такие как возраст и пол, состояние метаболизма и заболевание, изменяют функцию МСК и их соответствующий секретом, в настоящее время недостаточно изучены. Дальнейшее понимание влияния этих факторов будет иметь решающее значение для разработки и применения продуктов на основе секретома.

    3.2.2. Источник ткани

    Протеомные сравнения секретомов МСК, полученных из разных тканевых источников, выявили различные профили секретома. Между костным мозгом, жировой тканью и МСК, полученными из пульпы зуба, только 124 из 1533 идентифицированных белков были общими для всех трех источников [73].Эти обычно секретируемые белки являются факторами, функции которых связаны с биологическими эффектами, связанными с МСК. Другой сравнительный анализ периваскулярных клеток костного мозга, жировой ткани и пуповины выявил различные профили секретома нейрорегенеративных факторов [1]. Одно исследование показало, что полученные из желе MSC Wharton секретируют большее количество цитокинов, провоспалительных белков и факторов роста, в то время как те, которые получены из жировой ткани, имеют улучшенный ангиогенный профиль и секретируют большее количество белков внеклеточного матрикса (ECM) и металлопротеиназ [74].Повышенный ангиогенный профиль МСК, полученных из жировой ткани, был также подтвержден Hsiao et al. . [2]. В литературных источниках профили, секретируемые МСК из различных источников, относительно согласованы: эмбриональные стволовые клетки или стволовые клетки пуповинного происхождения демонстрируют усиленные пролиферативные молекулы и молекулы, вызываемые развитием, а также те из взрослых источников, таких как костный мозг и жировая ткань, секретирующие большее количество Белки, связанные с поддержанием ECM [15].

    Что касается электромобилей, то на сегодняшний день меньше исследований сравнивали профили различных источников MSC.МСК костного мозга и жировой ткани секретируют экзосомы с очень похожими профилями экспрессии РНК, но с отличительным обогащением специфическими тРНК [75]. Было показано, что по сравнению со стволовыми клетками, происходящими из костного мозга, пуповины и хориона, экзосомы, секретируемые МСК менструального происхождения, усиливают реакцию разрастания нейритов, имеющую отношение к выздоровлению от нейродегенеративных расстройств, таких как болезнь Паркинсона [76]. Очевидно, что источник клеток является важным аспектом развития процесса, который необходимо адаптировать к конкретным терапевтическим целям.Необходимы дальнейшие исследования, чтобы сопоставить влияние различных источников клеток на терапевтическую пользу для различных моделей заболеваний.

    3.3. Условия культивирования

    На характеристики МСК влияют параметры окружающей среды, включая температуру, pH, плотность клеток, при которых они засеваются, уровень кислорода и любые механические, электромагнитные или биохимические стимулы, которым они подвергаются. Условия культивирования могут действовать как регулятор для создания определенной популяции MSC с характеристиками, подходящими для конкретного применения.Следовательно, важно, чтобы условия культивирования соответствовали конкретному предполагаемому применению. Точно так же условия культивирования также влияют на состав и биоактивность секретома МСК в культуре. Следовательно, необходимо предпринять шаги, чтобы гарантировать, что определенный набор условий культивирования приводит к получению продуктов, полученных из секретома, ценных для конкретного применения.

    Один из способов изменить культуральную среду — изменить платформу, на которой растут клетки. Колбы для культивирования тканей (Т-колбы) обеспечивают простое средство для увеличения популяции клеток и обычно используются в небольших научных исследованиях.В Т-колбах МСК прилипают к поверхности и растут в статических условиях как двумерный монослой. Однако, учитывая масштабируемость для клинических приложений, большое количество необходимых Т-колб может привести к изменчивости от колбы к колбе, увеличивает вероятность контаминации и может быть трудоемким [53]. Другой распространенной платформой для размножения больших популяций клеток является биореактор с перемешиваемой суспензией, где клетки выращивают в суспензии при механическом перемешивании. МСК традиционно выращивают в суспензионных биореакторах в виде адгезивного монослоя путем добавления небольших шариков, называемых микроносителями, на которых клетки могут прикрепляться и расти [56].Суспензионные биореакторы обеспечивают более высокий уровень гомогенности и управления процессом, что позволяет снизить вариабельность культур клеток как от партии к партии, так и внутри партии. Кроме того, биореакторы с перемешиваемой суспензией обладают высокой масштабируемостью, и несколько переменных, таких как растворенный кислород, pH и температура, могут контролироваться компьютером, чтобы обеспечить высокий уровень управления процессом и, следовательно, более однородные партии продуктов. Использование биореакторной технологии было подробно рассмотрено Schnitzler et al. [56].

    Для выращивания MSC доступно множество платформ и методов. Различные эффекты этих платформ и методов должны быть реализованы на ранних стадиях разработки, чтобы обеспечить масштабируемый и эффективный клинический перевод. Важно дополнительно рассмотреть последствия различных условий культивирования в рамках выбранной платформы для культивирования, чтобы эффективно оптимизировать разработку продукта. Секретом МСК может быть адаптирован путем изменения условий культивирования, таких как принудительные межклеточные взаимодействия, уровень кислорода и воздействие механических сил или биохимических факторов (рис. 3), как описано ниже [24, 77].Достижения в понимании влияния различных условий культивирования на секретом МСК и / или заключенные в него ЭВ приведены в таблице 2.


    Уменьшение поверхности уровни экспрессии
    (ii) Уменьшение размера клеток
    (iii) Повышение остеогенной и адипогенной дифференцировки
    (iv) Различный профиль экспрессии генов Oxygen напряжение (гипоксия / аноксия) 5 T) 9098 0

    Источник МСК Режим культивирования Среда Результаты Ref.

    3D-культуры сфероидов
    Человеческие бедренные головы 3D-культура сфероидов в вращающихся колбах и сосудах с вращающейся стенкой α MEM + 15% FBS 90 i979 [77]
    Пуповинная кровь человека Сфероиды (метод висячей капли) DMEM + 10% FBS, 1% L-глутамин (i) IL-2R α , IL-7, IL-16, MCP-3, TGF- β 3 и VEGF обнаружены только в сфероиде CM
    ( ii) Значительное увеличение IL-6, MCP-1, LIF, G-CSF и SDF-1 α
    (iii) Снижение уровней TGF- β 1 и TGF- β 2 уровня
    (iv) Сниженный хемотаксический индекс клеток CD14 +
    (v) Повышенная способность стимулировать секреция сигнальных факторов
    [83]
    Человеческий костный мозг 3D сфероиды (метод висячей капли) CCM + 17% FBS (i) Более эффективен в подавлении воспалительных реакций в системе сокультивирования с LPS-активированным макрофаги
    (ii) Максимально экспрессируемые TSG-6
    (iii) Экспрессированные высокие уровни станниокальцина-1, IL-24, TNF- α -индуцирующего апоптоз лиганда и CD82
    (iv) 1/4 объема монослойные клетки
    [82]
    Человеческий костный мозг 3D сфероиды (метод «висящей капли») CCM + 17% FBS (i) Подавление LPS-стимулированных макрофагов, секретирующих провоспалительные цитокины α TNF- 9000, CXCL2, IL-12p40 и IL-23
    (ii) Повышенная секреция противовоспалительных цитокинов IL-10 и IL-1r α
    [28]
    Жировая ткань человека 3D сфероидов в суспензии с использованием сверхнизкий аттак Ментальные пластины α MEM + 10% FBS (i) Повышенная продукция VEGF, SDF и HGF
    (ii) Пониженная экспрессия проапоптотических маркеров
    [78]

    Жировая ткань человека Гипоксия (1% O 2 ) DMEM (i) Высшая экспрессия HIF-1 α
    (ii) Повышенное высвобождение ЭВ
    iii) Индуцированная сверхэкспрессия miRNA, вовлеченная в воспалительную (miR-223, -146b), пролиферативную и дифференцировочную фазы (miR-126, -199a) процесса заживления
    (iv) Усиленный процесс регенерации мышц
    [89]
    Человек Аноксия (0.1% O 2 ), гипоксия (5% O 2 ) α MEM +5 г / л глюкозы (i) CM от аноксических условий усиливает хемотаксические и проангиогенные свойства и снижает содержание медиатора воспаления
    ( ii) Повышенная экспрессия VEGF-A, VEGF-C, IL-8, RANTES и хемоаттрактантного белка моноцитов 1
    [86]
    Жировая ткань человека Гипоксия (5% O 2 ) RKCM (i) Усиленный антиапоптотический эффект
    (ii) Более высокие уровни GM-CSF, VEGF, IL-6 и IGF-1
    (iii) Более низкие уровни TGF- β 1
    [92]
    Пуповина человека Wharton jelly Гипоксия (5% O 2 ) PPRF-msc6 (i) Повышенный профиль секреции
    (ii) Значительно повышенная регуляция тимозина-бета и EF-2
    (iii) Повышенная нейрорегуляторная секреция профиль
    [90]
    Костный мозг человека Гипоксия (1% O 2 ) DMEM + 10% FBS + 2 мМ L-глутамин (i) Повышенная регуляция уровня белка виментина, фибронектина и N-кадгерина
    (ii) Гены повышенной стволовости Oct4, Nanog, Sall4 и Klf4
    (iii) Более высокие уровни остеокальцина и остеопонтина
    (iv) Пониженные уровни COL2A1, COMP и аггрекана
    (v) Пониженная экспрессия адипсина, FASN и FABP4
    (vi) Повышенная регуляция IGF, VEGF, EGF , GCSF, GM-CSF, TGF- β 1 и TGF- β 2
    [93]
    Человеческий костный мозг Гипоксия (1% O 2 ) с сывороточным голоданием Opti -MEM + 1% L-глутамин (i) Значительное увеличение белков, ограничивающих скорость гликолиза, и пути NRF2 / глутатиона
    (ii) Усиление ангиогенных путей PDGF, EGF и FGF
    (iii) Снижение секреции микровезикул , секреция экзосом существенно увеличилась
    [88]
    Костный мозг мыши w Повторяющиеся циклы аноксии StemPro MSC SFM (i) miR-11, miR-22, miR-24, miR-199a-3p и miR-210 активированы в экзосомах [91]
    Костный мозг человека Гипоксия в течение 30, 60 или 90 минут Неизвестно (i) 60-минутная группа имела наибольший защитный эффект на модель острого повреждения легких, вызванного эндотоксинами [94]

    Механические стимулы
    Костный мозг человека TGF- β 1 стимуляция (1 нг / мл) или механическая нагрузка (многоосевой сдвиг и сжатие) в каркасах из фибрин-поли (сложного эфира и уретана) 9000 α MEM + 10% FBS + 5 нг / мл bFGF (i) TGF- Стимуляция и нагрузка β 1 имели различные эффекты, оба улучшали хондрогенный профиль по сравнению с контролем
    (ii) Содержание нитритов в среде выше в загруженных группах
    (iii) TGF- β 1 усиленная экспрессия n лептина, рецептора лептина и MDC
    (iv) усиленная нагрузкой экспрессия uPAR, LAP, MIP3 , α , ангиогенина, ALCAM, ангиопоэтина 2, остеопротегерина и DR6; снижение экспрессии GRO
    (v) И TGF- β 1, и нагрузка усиливали экспрессию BLC, MCP3, MIF, VEGF, MMP13 и PDGFaa
    [100]
    Костный мозг человека Управляемый компьютером биореакторы, на микроносителях Cytodex 3 (2 г / л) PPRF-msc6 (i) Повышение нейрорегуляторного профиля секретома
    (ii) Повышение секреции Cys C, GDN, Gal-1 и PEDF
    (iii ) Повышающая регуляция miR-16
    (iv) Количество регуляторов ЦНС, обнаруживаемых только в КМ МСК, культивируемых в биореакторе
    (v) Повышающая регуляция классических трофических факторов BDNF, VEGF и IGF-1
    [16]
    Кость человека костный мозг Биореакторы DMEM + 10% FBS (i) Усиление ангиогенеза за счет CM от механически стимулированных MSC через сигнальные каскады FGFR и VEGFR
    (ii) Обогащение MMP-2, TGF- β 1 и b
    [102]
    Человек PAM hy дрогели различной жесткости DMEM с низким содержанием глюкозы + 10% FBS (i) VEGF, ангиогенин и IGF, повышенная регуляция с повышением модуля упругости
    (ii) EGF, IL-6 и IL-8 не зависели от жесткости
    [103]
    Жировая ткань Волокнистые каркасы из различно выровненных волокон α -MEM + 10% FBS (i) Более высокие уровни противовоспалительных и проангиогенных цитокинов были произведены из клеток, засеянных на электроспучке каркасы
    (ii) КМ из культур каркасов ускоряли закрытие раны и рекрутирование макрофагов в ложе раны
    [163]

    Электромагнитные стимулы
    Жировая ткань лошади DMEM / F12 + 10% FBS (i) Время удвоения достигнуто раньше, потенциал образования колоний выше
    (ii) Значительное увеличение количества секретируемых микровезикул
    (iii) Высвобождение BMP-2, VEGF , и р53 увеличен
    (iv) Сниженное высвобождение TNF- α
    [113]

    Биохимические стимулы
    Костный мозг человека IFN- γ α стимуляция DMEM с низким содержанием глюкозы (i) Повышенные уровни секреции IL-6, HGF, VEGF и TGF- β [119]
    Костный мозг мыши IFN- и либо TNF- α , IL-1 α , либо стимуляция IL-1 β α -MEM + 10% FBS + 2 мМ глутамин (i) Спровоцировала экспрессию CXCL-9 и CXCL-10 и индуцибельная синтаза оксида азота [118]
    Жировая ткань человека TGF- β 1 стимуляция DMEM + 0.1% БСА + 1% глутамин (i) Повышенная секреция PIGF, IGFBP-3, LIF, OSM, IL-4, IL-7, IL-13, CXCL9, CCL26 и OPN
    (ii) Пониженная секреция CCL7, CCL11, CXCL6, OPG, IL-5, IL-10, CCL8, CXCL1, CXCL10, HGF, лептин, FGF-7 и GM-CSF
    [123]
    Жировая ткань TNF- Стимуляция α MesenPRO RS Базальная среда + 2 мМ L-глутамин + MesenPRO RS Growth Supplement (i) TNF- α -предварительные ASC секретируют экзосомы с повышенным содержанием Wnt-3a
    (ii) Усиленная дифференцировка и дифференцировка осей в первичных остеобластных клетках человека
    [120]
    Пуповина человека Предварительное кондиционирование LPS DMEM с низким содержанием глюкозы + 10% FBS и бессывороточная среда с сигма-сывороточностью (i) Улучшенные регуляторные способности для поляризации и разрешения макрофагов хронического воспаления
    (ii) Уникальная экспрессия miR-let7b
    [115]
    Жировая ткань человека Предварительное кондиционирование LPS DMEM-низкий уровень глюкозы (i) Повышенная экспрессия мРНК IL-6, TNF- α , HGF и VEGF
    (ii) Усиленная регенерация печени, частично индуцированная регенерацией печени мыши
    [116]
    Жировая ткань человека H 2 O 2 стимуляция α -MEM + 10% экзо-свободный FBS (i) Экзосомы, бывшие H O 2 — стимулированное усиление восстановления кожного лоскута и плотности капилляров [121]

    3.3.1. Культура трехмерных сфероидов

    МСК могут расти в виде трехмерных (3D) агрегатов (сфероидов), где клетки прикрепляются друг к другу, а не к поверхности. Наиболее распространенным методом создания сфероидов является метод висящих капель, при котором маленькие капельки клеточной суспензии помещаются в статическую колбу для тканевых культур и культивируются в перевернутом виде над ванной с буферным раствором, таким как фосфатно-солевой буфер (PBS). Сфероиды также создавались спонтанно в пластинах с низким прикреплением, в системах на основе микролунок, таких как AggreWells, и в суспензионных биореакторах путем инокуляции клеток с высокой плотностью [77–79].По сравнению с традиционными двумерными адгезивными однослойными культурами, рост в виде трехмерных сфероидов считается более физиологически значимым [80]. Было показано, что МСК в трехмерных агрегатах проявляют повышенные противовоспалительные, ангиогенные и тканевые репаративные / регенеративные свойства [80]. Механофизические свойства сфероидов МСК кардинально различаются, с реорганизацией цитоскелета и изменениями в морфологии клеток, которые создают относительно меньшие клетки сферической формы. МСК, выращенные внутри сфероидов, также имеют значительные различия в экспрессии генов и улучшенных свойствах стволовых клеток (т.е., стволовость), включая улучшенный потенциал множественной дифференцировки [81].

    Аналогичным образом было продемонстрировано, что КМ, полученные из культур сфероидных МСК, более эффективны, чем МСК, выращенные в виде монослоя, в подавлении воспалительного ответа в стимулированных макрофагах в совместном культивировании и на модели мышей [28, 82]. Этот эффект объясняется значительно более высокими уровнями экспрессии противовоспалительных факторов TSG-6, STC-1 и CXCR4 и повышенной секрецией PGE2 как основного медиатора воспаления.КМ из сфероидных МСК ингибирует секрецию макрофагами провоспалительных цитокинов TNF- α , CXCL2, IL-12p40 и IL-23 и увеличивает их секрецию противовоспалительных цитокинов IL-10 и IL-2R α . Другое исследование выявило значительное снижение индекса хемотаксии клеток CD14 + при инкубации с микровезикулами, полученными из 3D-сфероидов MSC, по сравнению с микровезикулами, полученными из 2D-MSC. Это предполагает, что режим культивирования МСК может влиять на иммуномодулирующие характеристики полученной популяции микровезикул [83].

    МСК, культивируемые как трехмерные сфероиды, также проявляли повышенный уровень определенных белков и цитокинов с более чем чисто иммуномодулирующими эффектами, таких как антионкогенные белки IL-24, TNF- α , CD82, промотор васкулогенеза и ангиогенеза VEGF и белки, участвующие в дифференцировка и выживаемость клеток, таких как TGF- β 3 [82, 83]. Более того, МСК, выращенные в трехмерных сфероидах, совместно культивируемых с остеоартритическими хондроцитами, демонстрируют более высокий потенциал восстановления хряща по сравнению с таковыми, выращенными в виде двухмерного монослоя [84].Хотя существует ограниченное количество исследований влияния культуры сфероидов на многие аспекты секретома, можно было бы ожидать, что усиление межклеточного взаимодействия, изменение морфологии клеток и потенциально гипоксическая природа внутреннего микроокружения сфероида окажут большое влияние на состав полученного секретома МСК.

    3.3.2. Гипоксия / аноксия

    Большинство из культур in vitro подвергаются воздействию кислорода на уровне 21%. Поскольку МСК, как правило, не подвергаются воздействию таких высоких уровней кислорода в своей естественной среде, этот уровень кислорода можно рассматривать как гипероксический, состояние культивирования, которое, как сообщается, способствует окислительному стрессу и генетической нестабильности, приводящим к повреждению ДНК и сокращению продолжительности жизни [ 85].С другой стороны, аноксия, определяемая как уровень кислорода в свободном пространстве <1%, используется для моделирования условий ишемического повреждения in vitro . В то время как выживаемость МСК снижается с увеличением времени воздействия аноксии, недостаток кислорода может активировать высвобождение хемотаксических и ангиогенных медиаторов, имеющих решающее значение для регенерации и восстановления тканей [86]. Хотя это не обязательно напрямую отражает уровни кислорода, которым подвергаются клетки, кондиционирование МСК при концентрациях кислорода в свободном пространстве от 1 до 5%, часто называемых условиями гипоксического культивирования, используется как менее экстремальный метод, чем аноксия, для индукции активации. путей выживания и секреции продуктов, которые могут адаптировать клетки к стрессовой среде [24].Это привело к появлению популяций, которые демонстрируют повышенную кинетику роста, большую способность к дифференцировке и терапевтически желательные характеристики за счет активации индуцируемого гипоксией фактора- (HIF-) 1 α [87].

    Сообщалось, что гипоксия усиливает как профиль секреции МСК, так и количество высвобождаемых экзосом [88–90]. Наблюдалась сверхэкспрессия miRNAs, участвующих в воспалительной, пролиферативной и дифференцировочной фазах, включая miR-223, -146b, -126, -199a, -11, -22, -24 и -210 [89, 91].Это согласуется с активацией факторов, участвующих в клеточной пролиферации, дифференцировке, выживании, ангиогенезе, иммуномодуляции и / или нейрорегуляции, включая VEGF, GM-CSF, IGF-1, IL-6, EGF, FGF, PDGF и GCSF [88 , 90, 92, 93]. Более того, исследований in vivo продемонстрировали усиленную регенерацию мышц и повышенный защитный эффект при остром поражении легких, вызванном эндотоксинами, при введении предварительно кондиционированных гипоксией ЭВ, полученных из МСК [89, 94].

    Существуют некоторые расхождения между исследованиями в отношении усиления или подавления факторов, возникающих в результате различных концентраций кислорода, времени воздействия, источника клеток или среды культивирования.Паке и др. . [86] сообщил, что КМ из аноксических условий (0,1% O 2 свободное пространство) обладает улучшенными хемотаксическими и проангиогенными свойствами, наряду с пониженным содержанием медиатора воспаления, в то время как он не показал существенных различий между гипоксическими (5% O 2 свободным пространством). ) и нормоксических (21% O 2 свободное пространство) условиях, в отличие от других исследований. Сообщалось, что TGF- β 1 активируется при концентрации в свободном пространстве 1% O 2 [93], но снижается при 5% O 2 [92].Hung et al. [93] также показали усиление остеогенных и адипогенных факторов, но снижение хондрогенных факторов, в отличие от нескольких исследований, которые продемонстрировали усиление хондрогенеза в индуцированных гипоксией МСК [95–97]. Ли и др. [94] продемонстрировали важность времени воздействия в исследовании, в котором они подвергали МСК воздействию гипоксической среды в течение 30, 60 или 90 минут с разными результирующими профилями секретома.

    Секретом MSC очень динамичен, и существует явная потребность в точных отчетах при исследованиях давления кислорода.Хотя исследования сообщают о концентрации кислорода в воздухе, уровни растворенного кислорода, которым подвергаются клетки в культуре, могут различаться в зависимости от таких параметров, как глубина среды, плотность клеток и скорость потребления кислорода. Часто упускается из виду и время выдержки. Существуют различия между клетками, подвергшимися краткосрочному прекондиционированию гипоксией, и клетками, которые подверглись длительной экспансии в среде с низким содержанием кислорода. Сообщалось, что клетки, подвергшиеся гипоксии от пассажа 0 до пассажа 2, были способны к более быстрому размножению по сравнению с клетками, культивированными в нормоксии, и демонстрировали повышенную экспрессию генов, участвующих в сборке внеклеточного матрикса, нервном и мышечном развитии и развитии эпителия [98].Поскольку МСК демонстрируют измененные характеристики роста и экспрессию генов, вполне вероятно, что профиль секретома также будет изменен в таких обстоятельствах. Понятно, что условия гипоксии сильно влияют на терапевтические свойства МСК, но для правильного сравнения и воспроизведения результатов необходима стандартизация протоколов, связанных с гипоксией.

    3.3.3. Mechanical Stimuli

    МСК показали высокую механочувствительность [99]. Было показано, что на поведение клеток, такое как пролиферация и дифференцировка, а также на профиль их секретома, сильно влияют механические стимулы, такие как напряжение сдвига жидкости и сжатие [24, 100].МСК передают механические стимулы из окружающей их микросреды в биохимические сигналы посредством механотрансдукции [100]. Хотя большинство публикаций в этой области сосредоточено на механической стимуляции как средстве воздействия на клеточную дифференцировку [99, 101], становится все более очевидным, что паракринные факторы, генерируемые клетками, сильно зависят от их механической среды [16, 100, 102, 103]. Например, было обнаружено, что культивирование МСК на микроносителях в биореакторах с перемешиваемой суспензией, где клетки подвергаются воздействию сил сдвига жидкости, усиливает нейрорегуляторный профиль секретома, включая ряд регуляторов ЦНС, обнаруживаемых только в КМ МСК, культивируемых в биореакторе, а не в КМ клеток, выращенных в статических планшетах для тканевых культур [16].Классические трофические факторы BDNF, VEGF и IGF-1 также были активированы в культуре динамического биореактора [16]. Конструкции МСК, подвергнутые физиологической компрессии, имели усиленный ангиогенный профиль внутри КМ, который также был обогащен растворимыми регуляторами MMP-2, TGF- β 1 и bFGF [102]. Кроме того, воздействие на МСК многоосного сдвига и сжатия усиливало их хондрогенный профиль аналогично, но отчетливо, как тот, который вызывается стимуляцией TGF- β 1 [100]. Продукция оксида азота (NO) была значительно выше в нагруженных группах, при этом NO играл эффективную роль в иммуномодуляции МСК за счет подавления Т-клеточного ответа [100].

    МСК также реагируют на механические свойства своей подложки (т.е. поверхности, на которой они прикреплены), включая жесткость [99]. Жесткость матрикса может направлять дифференцировку клеток в направлении определенных клонов [99], и, как таковые, изменения состояния клеток изменяют секретом [100]. VEGF, ангиогенин и IGF активируются с увеличением модулей упругости, тогда как уровни EGF, IL-6 и IL-8 не реагируют на изменение жесткости [103]. Очевидно, что механическая стимуляция играет важную роль в определении состава и функции секретома, и дальнейшие исследования должны изучить способы использования динамических культур и механических свойств субстратов клеточных культур.

    3.3.4. Электромагнитные стимулы

    Воздействие на МСК электромагнитных полей (ЭМП) — еще одна стратегия влияния на поведение клеток, когда клетки общаются друг с другом посредством отправки и получения электромагнитных сигналов [104]. В богатых коллагеном тканях, таких как кости и хрящи, при приложении механических нагрузок возникают небольшие эндогенные электрические поля [105]. Таким образом, большинство исследований с участием МСК в этой области на сегодняшний день сосредоточено на остеогенной и хондрогенной дифференцировке посредством стимуляции ЭМП [106].Например, воздействие ЭМП на MSCs Wharton, полученное из желе (1,8 мТл, 75 Гц, 8 ч / день в течение 21 дня), увеличивало деление клеток и плотность клеток, индуцировало раннюю хондрогенную дифференцировку и повышало уровни экспрессии коллагена II [107]. Точно так же, хотя и зависит от интенсивности, времени воздействия и частоты ЭМП, воздействие ЭМП использовалось для усиления остеогенной и нервной дифференцировки [108–110], воздействия на метаболизм и структуру клеток [111] и повышения жизнеспособности клеток [112].

    Очень мало исследований было сосредоточено на влиянии ЭМП на секрецию МСК.Marędziak et al., . [113] сообщил, что в статическом магнитном поле (0,5 Тл) полученные из жировой ткани МСК секретируют значительно большее количество микровезикул по сравнению с контролем без магнитной стимуляции. Кроме того, микровезикулы, собранные из магнитно-стимулированных МСК, содержали большее количество BMP-2, VEGF и p53 и меньшее количество TNF-α . Таким образом, контроль воздействия ЭМП, наряду с механическими, электрическими и биохимическими стимулами, может предоставить значительную возможность для улучшения и оптимизации биопроцессов для продуктов, полученных из секретома МСК.

    3.3.5. Биохимические стимулы

    МСК также сильно зависят от прямых биохимических сигналов, вызываемых различными биомолекулами. Большая часть исследований с участием секретома МСК с точки зрения биохимической передачи сигналов основана на том факте, что стимулированные МСК высвобождают молекулы и ЭВ для противодействия таким биологическим сигналам и, таким образом, производят большее количество поддерживающих белков, миРНК, липидов и других метаболитов [114 ]. Один из способов вызвать провоспалительный стрессовый фенотип — это предварительное кондиционирование МСК липополисахаридом (ЛПС) [115, 116].В традиционных 2D однослойных культурах, по сравнению с контролем МСК, культивируемых без ЛПС, предварительное кондиционирование ЛПС индуцировало МСК с высвобождением провоспалительных цитокинов ИЛ-1 β , ИЛ-6, ИЛ-8, ИЛ-12, ИФН и ФНО- α. , что, в свою очередь, снижает секрецию провоспалительных цитокинов из других типов клеток [115, 116]. Прекондиционированные LPS экзосомы, полученные из МСК, вводили в модель кожной раны крысам с индуцированным стрептозотоцином диабетом и были способны повышать экспрессию противовоспалительных цитокинов и способствовать активации макрофагов M2 [115].У частично гепатэктомированных мышей внутривенное введение CM из LPS-прекондиционированных MSC снижает секрецию провоспалительных цитокинов IL-6 и TNF- α и усиливает регенерацию печени [116].

    МСК также продуцируют иммуномодулирующие и регенеративные факторы в ответ на воспалительные стимулы, такие как гамма-интерферон (IFN- γ ) и TNF- α . Было показано, что воздействие IFN- γ усиливает иммуносупрессивные свойства МСК за счет усиления или индукции факторов ингибирования МСК, подавления активации Т-клеток, усиления негативной передачи сигналов Т-клеток, изменения Т-клеток с провоспалительного на противовоспалительный фенотип, взаимодействия с антигеном. -представляющие клетки и увеличивающие или индуцирующие регуляторные клетки [117].Однако было показано, что IFN- γ сам по себе не вызывает иммуносупрессии, и только в сочетании с TNF- α , IL-1 α или IL-1 β иммуносупрессия с помощью МСК происходит. подавляют пролиферацию Т-клеток [118]. С любой из этих комбинаций МСК продуцировали несколько хемокинов, включая CXCL-9 и CXCL-10 в больших количествах [118]. Кроме того, для МСК, обработанных как IFN- γ , так и TNF- α , уровни секреции IL-6, HGF, VEGF и TGF- β были значительно увеличены, а уровни секреции при комбинации два были значительно выше, чем у IFN- γ или TNF- α отдельно [119].С другой стороны, экзосомы, предварительно кондиционированные TNF- α , способствовали пролиферации и остеогенной дифференцировке первичных остеобластических клеток человека [120].

    Перекись водорода (H 2 O 2 ) может быть использована для создания микроокружения, имитирующего ишемию. Хотя высокие концентрации H 2 O 2 могут вызывать гибель или повреждение клеток, низкие концентрации могут запускать процессы, обеспечивающие защитные эффекты от стрессовых состояний.Было показано, что стимуляция H 2 O 2 увеличивает экспрессию проангиогенных белков, таких как VEGF и HGF [121], а также секрецию IL-6 [122]. Bai et al. продемонстрировали, что МСК, стимулированные H 2 O 2 , усиливали их ангиогенный эффект на HUVEC и увеличивали выживаемость кожного лоскута в модели in vivo [121].

    Трансформирующий фактор роста — (TGF-) β 1 связан с клеточной пролиферацией, дифференцировкой, а также противовоспалительным и противовоспалительным действием.Воздействие TGF- β 1 модулирует секрецию МСК, изменяя секрецию цитокинов и хемокинов (перечисленных в таблице 2), участвующих в иммуносупрессии, аллергическом ответе и резорбции костей [123]. Такие исследования предоставляют доказательства того, что секретом может модулироваться биохимическими факторами, но все еще необходимо провести значительный объем исследований, чтобы оценить, как время воздействия и доза биохимической стимуляции влияют на результирующий профиль паракринного фактора для МСК.

    3.4. Изоляция

    Выделение продуктов, полученных из секретома МСК, является важным фактором при разработке биопроцессов из-за высокодинамичной природы секретома.Тип и количество секретируемых продуктов зависят от периода культивирования или фазы роста культуры, из которой выделяется секретом. Также необходимо учитывать метод выделения конкретных продуктов, в первую очередь электромобилей в среде. Как недавно было рассмотрено Ли и др. , существует множество проблем с современными методами изоляции ЭМ. [124] и Gholizadeh et al. [125]. Ультрацентрифугирование, хотя и способное работать с относительно большими объемами, и в настоящее время считается золотым стандартом для разделения этих структур, обеспечивает только степень извлечения до 25% и является длительным и сложным процессом [126].Есть также свидетельства того, что задействованные высокие силы (обычно 100 000) могут влиять на биоактивность самих электромобилей [127]. Механизмы исключения по размеру и захвата на основе антител ограничены низкой пропускной способностью и необходимостью заключительного этапа концентрирования [128]. Кроме того, использование механизмов на основе антител ограничено во многих приложениях из-за высокой стоимости. Микрогидравлические подходы позволяют одновременно изолировать и охарактеризовать электромобили, но восстановление электромобилей с таких устройств остается сложной задачей [125].Совсем недавно анионообменная хроматография была использована для выделения EV в одну стадию с высокой чистотой, которая использует отрицательный заряд EV [129]. Существует большая потребность в технологиях изоляции EV, которые обеспечивают высокую пропускную способность, поддерживают целостность и биоактивность EV и не являются чрезмерно дорогостоящими для клинических приложений. Будет важно использовать внутренние свойства электромобилей для разработки экономичных методов изоляции в будущем.

    3.5. Хранение

    При хранении и транспортировке продуктов, полученных из секретома MSC, важно учитывать эффекты замораживания-оттаивания, стабильность при различных температурах и эффекты лиофилизированных компонентов.Сообщается, что КМ можно хранить при -20 ° C в течение нескольких месяцев без ухудшения функций [130]. Для электромобилей было показано, что замораживание-оттаивание не влияет на размер экзосом и не нарушает целостность мембран, но уменьшение размера происходит на 60% через 2 дня при физиологической температуре 37 ° C, а также уменьшение через 3 дня. –4 дня при 4 ° C [131]. При замораживании при -20 ° C экзосомы стабильны в течение 6 месяцев без потери их биохимической активности [9]. Однако исследование Чжоу и др. . [132] продемонстрировал, что ингибиторы протеаз необходимы для надлежащего хранения, и замораживание экзосом мочи при -20 ° C приводит к большим потерям, в то время как замораживание при -80 ° C позволяет почти полностью выздороветь после 7 месяцев хранения. Кроме того, интенсивное встряхивание (т.е. 90 секунд) позволило максимально восстановить размороженные образцы экзосом. Эти исследования демонстрируют, что экзосомы могут подвергаться длительному хранению с высокой степенью извлечения без потери биоактивности. По сравнению с клетками, которые проявляют нарушенные терапевтические свойства в результате замораживания-оттаивания и требуют использования консервантов для надлежащего криохранилища, продукты, полученные из секретома, более поддаются хранению, что является ключевым моментом с точки зрения трансляции [53].

    3,6. Доставка

    Доставка продуктов, полученных из секретома, in vivo имеет те же ограничения, что и клеточная терапия. В большинстве исследований используется простая внутривенная инъекция питательной среды или ЭВ в PBS в место повреждения. Несмотря на способность экзосом проникать в ткани-мишени, задержка в этих областях ограничена, и для эффективного лечения необходимо выполнять повторные инъекции [133]. В одной публикации описывается использование фотоиндуцированного имин-перекрестно-сшивающего гидрогеля, который может быть встроен в экзосомы и использоваться в качестве тканевого пластыря из гидрогеля [133].Клетки смогли мигрировать в гидрогель и интернализовать инкапсулированные экзосомы. Gangadaran et al. [134] также продемонстрировали повышенное удержание EV в месте повреждения при смешивании и инъекции с каркасом Matrigel. Такая система предотвращает миграцию продуктов клеточного происхождения, таких как экзосомы, из целевого сайта и обеспечивает лучшую интеграцию для восстановления тканей. В зависимости от применения таких терапевтических средств, полученных из клеток, гидрогелевые системы могут обеспечивать более эффективное лечение за счет медленного высвобождения продуктов для предотвращения быстрого очищения участков или преждевременной деградации.

    Экзосомы, происходящие из

    MSC, также были успешно доставлены посредством интеграции в тканевую кость [135] и в хирургическую сетку из фибрина [136]. Экзосомы добавляли для улучшения заживления и для стимулирования миграции клеток в каркасы. В то время как основные цели этих исследований состояли в том, чтобы улучшить результаты таких конструкций, успех интеграции и удержания EV предлагает дополнительную перспективу для использования бесклеточных терапевтических средств.

    4. Выводы

    В недавних сообщениях, объясняющих основные терапевтические преимущества МСК их паракринными эффектами, секретом и составляющие его экзосомы могут представлять собой новый и более безопасный подход к лечению заболеваний по сравнению с прямой клеточной терапией.Тот факт, что секретом и его компоненты неживые, будет способствовать разработке терапевтических стратегий, которые могут обеспечить более высокую стерильность, более низкий иммунный ответ и простоту транспортировки и хранения. Понимание того, как источник клеток, среда и условия культивирования взаимодействуют для определения количества, качества и типов секретируемых биомолекул, необходимо для разработки биопроцессов, направленных на увеличение производства продуктов, полученных из секретома. Кроме того, стандартизация протоколов выделения, характеристики, хранения и доставки необходима для надлежащего сравнения исследований и обеспечения эффективного контроля качества.

    Сокращения
    Essential Щелочная фосфатаза -9097-B-лимфоцит-хемо-—-B-лимфоцит Хроническая болезнь почек CKD 9097: Хроническая болезнь почек 909 74 ЦНС: l Внеклеточный матрикс EGG EGFR: Fatty-acid-связывающий белок синтаза Связанный с GRO974 -фактор роста гепатоцитов Рецептор инсулиноподобного фактора роста MIP NADH: артериальная гипертензия Гиперпрессор легочной артерии SpA обратная транскрипция Трансформация бета-фактора Трансформация ТБ: Трансформирующий бета-фактор Фактор роста сосудов Ксено-свободный.
    Akt: Протеинкиназа B
    ALCAM: Активированная молекула адгезии лейкоцитов
    α Alpha
    АТФ: Аденозинтрифосфат
    bFGF: Основной фактор роста фибробластов
    BLC: B-лимфоцит
    CCL: Хемокин (мотив CC) лиганд
    CCM: Полная питательная среда
    CD: Кластер дифференцировки
    CM: Кондиционированная среда
    Центральная нервная система
    COMP: Белок олигомерного матрикса хряща
    CTX: Кардиотоксин
    CXCL: Хемокистин Цистатин
    DMEM: Среда Игла, модифицированная Дульбекко
    DR6: Рецептор смерти 6
    ECM: Фактор роста Рецептор эпидермального фактора роста
    EMF: Электромагнитное поле
    EV: Внеклеточный пузырек
    FABP:
    FBS: Плод крупного рогатого скота сыворотка
    FGF: Фактор роста фибробластов
    Gal: Галактозидаза
    GAP: Рост-ассоциированный белок
    GCF-9097-G GCF-
    Гранулоцитарный колониестимулирующий фактор
    GDN: Глиа-производный нексин
    GM-CSF: Гранулоцитарный макрофагальный колониестимулирующий фактор
    GvHD: Болезнь трансплантат против хозяина
    H 2 O 2 : Перекись водорода
    HGF: Фактор роста гепатоцитов
    HPL: Лизат тромбоцитов человека
    HUVEC: H Эндотелиальная клетка пупочной вены умань
    IFN: Интерферон
    IGF: Инсулиноподобный фактор роста
    IGFBP: Инсулиноподобный белок, связывающий фактор роста
    IL: Интерлейкин
    LAP: Пептид, связанный с латентностью
    LIF: Фактор ингибирования лейкемии
    MCP: Хемотаксический белок моноцитов
    MDC: Хемокин, полученный из макрофагов
    MIF: Фактор ингибирования миграции макрофагов Матричная металлопротеиназа
    MS: Рассеянный склероз
    MSC: Мезенхимальные стволовые клетки
    MVB: Мультивезикулярное тело
    NADH: adenineduinamide adenineduinamid
    OPG: Остеопротегерин
    OPN: Остеопонтин
    OSM: Онкостатин M
    P53:
    PDGF: Фактор роста, полученный из тромбоцитов
    PEDF: Фактор, полученный из пигментного эпителия
    PIGF: Фактор роста плаценты
    Нормальный RANTES Нормальный RANTES клетка экспрессируется и секретируется
    RGC: 9 0979 ганглиозная клетка сетчатки
    АФК: Активные формы кислорода
    РНК: Рибонуклеиновая кислота
    RT-qPCR:
    SDF: Фактор, производный от стромальных клеток
    SF: Без сыворотки
    SFM: Среда, не содержащая сыворотки
    STC: Стрептозоцин
    СД1: Сахарный диабет 1 типа
    СД2: Сахарный диабет 2 типа
    ТБ: ТБ:
    Th: Т-помощник
    TNF: Некроз опухоли Фактор
    TSG: Ген-белок, индуцируемый фактором некроза опухоли
    uPAR: Рецептор активатора плазминогена урокиназного типа
    VEGF:
    Конфликты интересов

    В соответствии с лицензионным соглашением между Stemcell Technologies Inc. и доктором Унгрином / Университетом Торонто, доктор Унгрин имеет право на долю роялти от продаж технологии AggreWell. Это никоим образом не повлияло на нейтралитет или объективность этой статьи и не влияет на приверженность авторов политике журнала в отношении обмена данными и материалами.

    Клонирование стимулированного интерфероном гена 17: промотор и ядерные белки, регулирующие транскрипцию | Молекулярная эндокринология

    Аннотация

    Член семейства интерферон-стимулированных генов (ISG) кодирует 17-кДа гомолог убиквитина, называемый ISG17, который индуцируется в эндометрии матки крупного рогатого скота с помощью интерферона-τ (IFN-τ) на ранних сроках беременности.КДНК ISG17 крупного рогатого скота (b) имеет 30% идентичности с тандемным убиквитиновым повтором и 70% идентичности с ISG15 человека (h). Настоящие эксперименты были разработаны для секвенирования гена bISG17, сравнения общей структуры с геном hISG15 и для идентификации факторов транскрипции, которые индуцировались IFN-τ в клетках эндометрия крупного рогатого скота (BEND). Промотор гена bISG17 был подобен гену hISG15 в размещении тандемного IFN-стимулирующего ответного элемента (ISRE) в положении -90, но уникален в присутствии трех дополнительных ISRE в положениях -123, -332 и -525. .IFN-τ (25 нм) индуцировал ядерные белки в клетках BEND, которые взаимодействовали с тандемным ISRE bISG17 в анализе сдвига электрофоретической подвижности (EMSA). IFN-регуляторный фактор-1 (IRF-1), связанный с этим ISRE, основан на сверхсдвигающем EMSA с использованием антисыворотки против IRF-1. IFN-τ активировал STAT-1 (преобразователь сигнала и активатор транскрипции-1) и -2 через 0,5 ч, а IRF-1 через 2 ч в клетках BEND. Сделан вывод, что ген bISG17 подобен гену hISG15, сохраняет ISRE, который взаимодействует с IRF-1, и, возможно, сначала индуцируется STAT, а затем IRF-1 в ответ на IFN-τ на ранних сроках беременности.

    Введение

    Литический эффект простагландина F 2 α (PGF) необходимо избегать на ранних сроках беременности (1). В противном случае желтое тело регрессирует в ответ на снижение PGF и прогестерона, что приводит к ранней эмбриональной смертности. У жвачных животных беременность наступает благодаря действию интерферона-τ (IFN-τ) на эндометрий (1–3). IFN-τ высвобождается расширяющейся бластоцистой, связывается с рецептором эндометрия и изменяет характер секреции PGF маткой.Это приводит к спасению желтого тела и продолжению выработки прогестерона. Поскольку IFN-τ косвенно блокирует литическое действие PGF на желтое тело, его назвали «антилютеолизином». Антилютеолитический механизм действия IFN-τ (1, 2) включает ингибирование рецепторов эстрадиола, снижение рецептора окситоцина, активацию ингибитора циклооксигеназы и сдвиг PG в пользу PGE 2 , лютеотропина, по сравнению с PGF, лютеолизин.

    Помимо регуляции высвобождения PGF, IFN-τ индуцирует несколько белков матки (2, 4, 5).Функция этих белков на ранних сроках беременности остается неуловимой, за исключением гомолога бычьего убиквитина массой 17 кДа. Этот белок первоначально назывался перекрестно-реактивным белком убиквитина, или UCRP, потому что он имел общие эпитопы с убиквитином и перекрестно реагировал с антисывороткой против убиквитина при вестерн-блоттинге (6).

    Конъюгация убиквитина с белками осуществляется за счет изопептидной связи между карбоксилглицином убиквитина и первичными аминами на целевых белках (7, 8).Белки, конъюгированные с убиквитином, процессируются посредством АТФ-зависимого мультикаталитического пути 26 S протеасомы, в котором целевые белки разрушаются, а убиквитин рециклируется (9). Гипотеза о том, что бычий (b) UCRP конъюгирован с белками эндометрия, была недавно проверена (10). Было продемонстрировано, что конъюгация UCRP отличается от конъюгации убиквитина с белками эндометрия (10). Кроме того, конъюгация bUCRP с белками эндометрия была вызвана беременностью и IFN-τ, тогда как конъюгация убиквитина с белками эндометрия — нет.

    Клонирование кДНК bUCRP и анализ предполагаемой аминокислотной последовательности выявили 70% идентичности с человеческим членом семейства IFN-стимулированных генов (ISG), который кодирует белок массой 15 кДа (ISG15), и 30% идентичности с тандемом бычий убиквитиновый повтор (11). И IFN-α, и IFN-τ индуцировали мРНК и белок bUCRP в клетках эндометрия крупного рогатого скота (6, 12, 13). Поскольку ген bUCRP принадлежит к семейству ISG и кодирует белок массой 17 кДа, мы переименовали белок ISG17 в соответствии с номенклатурой, разработанной для человеческих ISG15 (14) и ISG54 (15).

    IFN — это иммуномодулирующие белки, которые обладают различными клеточными эффектами в зависимости от клеточного происхождения и стадии дифференцировки (16). IFNs связываются с трансмембранными рецепторами, активируют янус-киназу (Jak) или тирозинкиназу (Tyk) и стимулируют быструю активацию экспрессии генов (17). Сигнальные преобразователи и активаторы транскрипции (STAT) представляют собой цитоплазматические факторы транскрипции, которые фосфорилируются Jaks и взаимодействуют как гетеро- или гомодимеры, регулируя транскрипцию генов. Было высказано предположение, что STAT опосредуют ранние геномные ответы на IFN (17).IFN-регуляторный фактор-1 (IRF-1), фактор транскрипции, индуцируется STAT, фосфорилируется и может опосредовать дистальные ответы на IFN (18).

    Ген bISG17 можно использовать для исследования передачи сигнала в эндометрии в ответ на IFN-τ (13). bISG17 значительно отличается по обработке и первичной структуре по сравнению с hISG15. Еще одно важное различие между hISG15 и bISG17 — очевидная широко распространенная экспрессия hISG15 в нескольких клеточных линиях и тканях (19). Нозерн-блоттинг показал, что экспрессия гена bISG17 ограничена эндометрием беременных коров или эндометрием небеременных коров, которые лечили in vitro рекомбинантным бычьим (rb) IFN-τ или rbIFN-α (12).Хотя роль hISG15 может быть общей для многих типов клеток, транскрипция гена bISG17, по-видимому, является специфическим ответом на IFN-τ в эндометрии матки на ранних сроках беременности у коровы (12). Таким образом, цели настоящих экспериментов состояли в том, чтобы выделить и секвенировать ген bISG17, сравнить структуру и организацию с геном hISG15 и определить, индуцируются ли факторы транскрипции STAT-1, STAT-2, IRF-1 и IRF-2 под действием IFN-τ и участвует в регуляции гена bISG17.

    Результаты

    Саузерн-блот анализ

    ДНК тимуса теленка расщепляли эндонуклеазами рестрикции и проводили блоттинг по Саузерну с использованием кДНК bISG17 (11) в качестве зонда.Расщепление геномной ДНК ферментами, которые не расщепляют кДНК, привело к образованию одной основной полосы гибридизации с другими второстепенными полосами гибридизации (рис. 1А). Основная гибридизирующая полоса в основном исчезла после переваривания геномной ДНК с помощью Pst I, Sma I и Sac I, которые, как известно, расщепляют кДНК bISG17 (11). Поскольку после переваривания с Sac I появились две более короткие полосы гибридизации, данные интерпретируются как означающие, что существует единственный главный ген, кодирующий bISG17.Фрагменты Sac I имели размер приблизительно 3,4 и 2,0 т.п.н. Даже в условиях нестрогой гибридизации (, т.е. 37 ° C), зонд кДНК bISG17 не гибридизировался с геномной ДНК человека, которая была расщеплена и подвергнута Саузерн-блоттингу, как описано для геномной ДНК крупного рогатого скота (не показано).

    Рис. 1.

    Идентификация гена bISG17 в геномной ДНК крупного рогатого скота (A) и в очищенном фаге (B) с использованием саузерн-блоттинга и зонда кДНК bISG17 На панели A стрелки указывают продукты расщепления с использованием Sac I, который, как известно, расщепляет кДНК.На панели B полоса 1 представляет окрашивание бромистым этидием фага, расщепленного Sac I, который содержит ген bISG17. Дорожка 2 представляет собой Саузерн-блоттинг фага, расщепленного Sac I, с использованием кДНК bISG17 в качестве зонда. Фрагменты гена bISG17, субклонированные в pBluescript SK, обозначены как pDP7 и pDP8.

    Рис. 1.

    Идентификация гена bISG17 в геномной ДНК крупного рогатого скота (A) и в очищенном фаге (B) с использованием саузерн-блоттинга и зонда кДНК bISG17 На панели A стрелки указывают продукты расщепления с использованием Sac I. , который, как известно, расщепляет кДНК.На панели B полоса 1 представляет окрашивание бромистым этидием фага, расщепленного Sac I, который содержит ген bISG17. Дорожка 2 представляет собой Саузерн-блоттинг фага, расщепленного Sac I, с использованием кДНК bISG17 в качестве зонда. Фрагменты гена bISG17, субклонированные в pBluescript SK, обозначены как pDP7 и pDP8.

    Выделение геномного клона bISG17

    Отдельный фаг был выделен и очищен после скрининга 1 × 10 6 бляшек из геномной библиотеки крупного рогатого скота.Фаг, содержащий вставку размером 16 т.п.н., расщепляли Sac I и проводили блоттинг по Саузерну с использованием радиоактивно меченного кДНК-зонда bISG17. Два фрагмента Sac I гибридизировались с зондом кДНК bISG17 (рис. 1В). Эти фрагменты имели длину 3,4 и 2 т.п.н. и идентичны по размеру с фрагментами, идентифицированными на геномных саузерн-блотах после переваривания Sac I. Фрагменты Sac I очищали в геле, субклонировали в pBluescript SK и называли pDP7 (3,4 т.п.н. ) и pDP8 (2,0 кб).

    Первоначальное секвенирование со стандартными праймерами показало, что промотор и большинство кодирующих последовательностей содержатся в pDP8.Следовательно, эту плазмиду использовали для создания вложенных делеций путем частичного переваривания экзонуклеазой III и полностью секвенировали. Все последовательности были подтверждены перекрывающимися клонами и, при необходимости, с использованием внутренних праймеров. 3′-конец кодирующей последовательности и нижележащие некодирующие последовательности секвенировали из плазмиды pDP7 с использованием стандартных праймеров.

    Последовательность гена bISG17 и его промотора, включая 1180 п.н. перед сайтом старта транскрипции, показана на рис.2. Регистрационный номер GenBank — AF069133. Ген содержит предполагаемый элемент TATA-бокса (TATTAAA) в положении -29 относительно кэп-сайта мРНК и возможный перевернутый элемент CAAT-бокса в положении -130. За сайтом кэпа мРНК следуют 5′-некодирующие последовательности и инициирующий кодон. Сразу после инициирующего кодона находится интрон длиной 437 п.н., за которым следуют оставшиеся кодирующие последовательности и 3′-нетранслируемые последовательности, которые были идентичны таковым, описанным для кДНК bISG17 (11).

    Фиг.2.

    Нуклеотидная последовательность

    и выведенная аминокислотная последовательность гена bISG17 (A), сравнение с промотором hISG15 (B) и идентификация кэп-сайта мРНК (C). Фрагменты гена bISG17 (pDP7 и pDP8) были клонированы в pBluescript SK и секвенированный. Кодирующие белки последовательности обозначены прописными буквами . ISRE выделены жирным шрифтом , выделены полужирным шрифтом . Предполагаемый блок ТАТА, инвертированный элемент СААТ и сигнал полиаденилирования — подчеркнуты . Потенциальный мотив CREB — , выделенный жирным курсивом , а мотивы GAAANN — жирным шрифтом .Нумерация относится к сайту начала транскрипции РНК, обозначенному курсивом g в рамке, g . Панель B показывает гомологию нуклеотидных последовательностей между промоторами bISG17 и hISG15. Две нуклеотидные последовательности выровнены от -140 гена bISG17 до первых 17 нуклеотидов интрона. Идентичность нуклеотидов обозначена вертикальными линиями . Стрелки под последовательности ISG15 указывают вставки относительно последовательности ISG17. Тандемные ISRE и вышестоящие ISRE обозначены жирным подчеркнутым шрифтом .Предполагаемый элемент CREB выделен полужирным шрифтом и курсивом . Сайт кэпа мРНК обозначен жирным курсивом g , а начало трансляции обозначено заглавными буквами . Панель C показывает анализ удлинения праймера кэп-сайта мРНК bISG17. Нуклеотидная последовательность гена bISG17 с использованием праймера показана с нуклеотидами, обозначенными как G, A, T и C. Показаны более длинный (L) и более короткий (S) способы гибридизации. РНК эндометрия небеременных (NP) или беременных (P) коров использовали в качестве матрицы.Нуклеотидная последовательность, кодирующая кэп-сайт, показана ниже геля. Возможные участки заглушки показаны более короткими стрелками . Сайт, обозначенный как положение +1 в последовательности, обозначен самой длинной стрелкой , потому что это всегда был самый темный сигнал с использованием L-метода и соответствовал одному из сайтов, идентифицированных с помощью S-метода.

    Рис. 2.

    Нуклеотидная и выведенная аминокислотная последовательность гена bISG17 (A), сравнение с промотором hISG15 (B) и идентификация участка кепки мРНК (C) Фрагменты гена bISG17 (pDP7 и pDP8) ) были клонированы в pBluescript SK и секвенированы.Кодирующие белки последовательности обозначены прописными буквами . ISRE выделены жирным шрифтом , выделены полужирным шрифтом . Предполагаемый блок ТАТА, инвертированный элемент СААТ и сигнал полиаденилирования — подчеркнуты . Потенциальный мотив CREB — , выделенный жирным курсивом , а мотивы GAAANN — жирным шрифтом . Нумерация относится к сайту начала транскрипции РНК, обозначенному курсивом g в рамке, g . Панель B показывает гомологию нуклеотидных последовательностей между промоторами bISG17 и hISG15.Две нуклеотидные последовательности выровнены от -140 гена bISG17 до первых 17 нуклеотидов интрона. Идентичность нуклеотидов обозначена вертикальными линиями . Стрелки под последовательности ISG15 указывают вставки относительно последовательности ISG17. Тандемные ISRE и вышестоящие ISRE обозначены жирным подчеркнутым шрифтом . Предполагаемый элемент CREB выделен полужирным шрифтом и курсивом . Сайт кэпа мРНК обозначен жирным курсивом g , а начало трансляции обозначено заглавными буквами .Панель C показывает анализ удлинения праймера кэп-сайта мРНК bISG17. Нуклеотидная последовательность гена bISG17 с использованием праймера показана с нуклеотидами, обозначенными как G, A, T и C. Показаны более длинный (L) и более короткий (S) способы гибридизации. РНК эндометрия небеременных (NP) или беременных (P) коров использовали в качестве матрицы. Нуклеотидная последовательность, кодирующая кэп-сайт, показана ниже геля. Возможные участки заглушки показаны более короткими стрелками . Сайт, обозначенный как положение +1 в последовательности, обозначен самой длинной стрелкой , потому что это всегда был самый темный сигнал с использованием L-метода и соответствовал одному из сайтов, идентифицированных с помощью S-метода.

    Промотор содержит пять предполагаемых IFN-стимулирующих ответных элементов (ISRE) в положениях от −525 до −513, от −332 до −320, от −123 до −111 и пару тандемных, перекрывающихся ISRE в положениях от −92 до −74. (Рис.2, А и Б). Мотив последовательности GAAANN, который обнаружен в промоторах генов IFN-α , и IFN-τ (20), обнаруживается не менее 17 раз в обеих ориентациях в области от -170 до -1060. , CREB-подобная последовательность находится в положениях от -48 до -41. Общая структура кодирующих областей аналогична генам bISG17 и hISG15 (14) с интроном сразу после кодона инициации.Кодирующие области имели 68% идентичность последовательностей, как сообщалось ранее (11). Оба гена сохраняли тандемный перекрывающийся ISRE примерно на 50 п.н. выше ТАТА-бокса (рис. 2В). Ген hISG15 был секвенирован в положение -125 (фиг. 2B), тогда как ген bISG17 был секвенирован в положение -1180 (фиг. 2A).

    Определение сайта начала транскрипции

    Сайт кэпа мРНК для гена bISG17 определяли с помощью анализа удлинения праймера общей РНК эндометрия, выделенной от коров на 18 день беременности (рис.2С). Суммарная РНК эндометрия коровы на 18 день эстрального цикла служила контролем. Был выбран олигонуклеотидный праймер для гибридизации с мРНК в положении, которое находилось на 15 п.н. выше кодона инициации ATG на основе последовательности кДНК bISG17 (11). Наращивание праймера было выполнено двумя способами. В условиях длительной гибридизации с высоким содержанием соли были получены два основных сайта старта транскрипции. Более короткие условия гибридизации с низким содержанием соли дали четыре основных стартовых сайта. Использование второго олигонуклеотидного праймера (GCCAGGCTCTCTGCAGACAC), заканчивающегося на 36 п.н. выше инициирующего кодона, подтвердило эти результаты (не показаны).Хотя эти результаты могут представлять несколько сайтов начала транскрипции, первый нуклеотид G в серии был обозначен как положение 1, потому что соответствующая полоса является самой темной в длинном эксперименте по гибридизации. Ни одним из методов не было обнаружено транскриптов в общей РНК из эндометрия, собранной на 18 день эстрального цикла.

    Emsa

    Тандемный ISRE в гене bISG17 практически идентичен тандемному ISRE гена hISG15 (14).Между двумя последовательностями различается только один нуклеотид: замена G на A в вариабельной части консенсусной последовательности hISRE (рис. 2B). Тандемный ISRE bISG17 был синтезирован, мечен радиоактивным изотопом и использован в качестве зонда в EMSA с использованием ядерных экстрактов из обработанных IFN клеток эндометрия крупного рогатого скота (BEND).

    Радиоактивно меченый олигонуклеотид, инкубированный в отсутствие ядерных экстрактов, имел самую быструю электрофоретическую подвижность (фиг. 3A). Конститутивное взаимодействие ISRE с ядерными экстрактами было отмечено как в контрольных, так и в обработанных IFN клетках BEND.В течение 2-часового периода эта более быстро мигрирующая составляющая полоса активировалась после инкубации с IFN-α или IFN-τ. Ядерные экстракты из клеток, обработанных IFN-α или IFN-τ в течение 2 часов, также имели одну уникальную более медленную полосу миграции, которая не была обнаружена в контроле. На уровне чувствительности этого анализа не было никакой разницы в ядерных белках, которые были связаны с энхансером ISRE в ответ на два протестированных IFN.

    Рис. 3.

    EMSA ядерных экстрактов из контрольных и обработанных IFN клеток BEND (панель A) и конкуренция с немеченым ISRE (панель B). Ядерные экстракты выделяли из клеток BEND, обработанных 0 (C) или 25 нМ IFN- α (A) или IFN-τ (T), как указано.Пять микрограммов экстракта инкубировали с 20000 имп / мин меченого олигонуклеотида ISRE (GGGAAAAGGAAACCGAAACT), разделяли на неденатурирующем 6% акриламидном геле и подвергали авторадиографии. Жирная стрелка отмечает миграцию свободного олигонуклеотида. Более светлая стрелка указывает смещенную полосу, появившуюся после обработки IFN. На панели B EMSA была завершена с использованием ядерных экстрактов, собранных после 1 или 2 ч культивирования с 25 нМ rbIFN-τ. Ядерные экстракты инкубировали с радиоактивно меченным ISRE в отсутствие или в присутствии 1-, 10- или 100-кратного молярного избытка немеченого ISRE.

    Рис. 3.

    EMSA ядерных экстрактов из контрольных и обработанных IFN клеток BEND (панель A) и конкуренция с немеченым ISRE (панель B) Ядерные экстракты были выделены из клеток BEND, обработанных 0 (C) или 25 нМ IFN. -α (A) или IFN-τ (T), как указано. Пять микрограммов экстракта инкубировали с 20000 имп / мин меченого олигонуклеотида ISRE (GGGAAAAGGAAACCGAAACT), разделяли на неденатурирующем 6% акриламидном геле и подвергали авторадиографии. Жирная стрелка отмечает миграцию свободного олигонуклеотида.Более светлая стрелка указывает смещенную полосу, появившуюся после обработки IFN. На панели B EMSA была завершена с использованием ядерных экстрактов, собранных после 1 или 2 ч культивирования с 25 нМ rbIFN-τ. Ядерные экстракты инкубировали с радиоактивно меченным ISRE в отсутствие или в присутствии 1-, 10- или 100-кратного молярного избытка немеченого ISRE.

    Взаимодействие радиоактивно меченного ISRE с ядерными экстрактами клеток BEND, индуцированное IFN-τ, было специфическим, как показано на фиг. 3B. Коинкубация с 10- и 100-кратным молярным избытком холодного ISRE эффективно блокировала связывание ядерных белков с радиоактивно меченным ISRE, о чем свидетельствует исчезновение как более быстро мигрирующей составляющей полосы, так и более медленной мигрирующей полосы, которая индуцировалась IFN.

    Вестерн-блоттинг STAT и IRF-1

    Ядерные экстракты собирали несколько раз после обработки клеток BEND 25 нм rbIFN-τ или rbIFN-α и вестерн-блоттинга с использованием антител против STAT-1, STAT-2 и IRF-1. В этих экспериментах предполагалось, что транслокация этих факторов транскрипции в ядро ​​требует фосфорилирования и что обнаружение в ядре представляет активацию этих факторов транскрипции. Репрезентативные вестерн-блоты, показывающие обнаружение STAT-1, STAT-2 и IRF-1 в клетках BEND, можно найти на рис.4А. Количественное определение этих блотов выявило, что оба IFN активировали STAT-1 (фиг. 4B) и STAT-2 (фиг. 4C) в клетках BEND в течение 0,5 часа и IRF-1 в течение 2 часов (фиг. 4D). Для индукции IRF-1 требовалось более длительное время инкубации (2 ч) с IFN по сравнению с индукцией STAT. Более чем один ядерный белок иммунореагировал с антисывороткой против IRF-1.

    Рис. 4.

    Обнаружение STAT-1 (91 и 84 кДа), STAT-2 (113 кДа) и IRF-1 (37 кДа) в экстрактах ядер клеток BEND с использованием вестерн-блоттинга. соответствующий 37 кДа форме IRF-1 показан стрелкой .Клетки BEND инкубировали в течение 0, 0,5 или 2 ч в отсутствие (C) или в присутствии 25 нм rbIFN-α (A) или rbIFN-τ (T). Ядерные экстракты выделяли, разделяли (4 мкг) на SDS-полиакриламидных (7,5%) гелях, переносили на нитроцеллюлозу и детектировали с помощью антисывороток против STAT-1, STAT-2 или IRF-1. Вестерн-блоты количественно оценивали с помощью денситометрии. Оптическую плотность анализировали с помощью защищенного t -теста. Панели B, C и D показывают количественное определение STAT-1, STAT-2 и IRF-1 соответственно. Все средства обработки представляют собой повторные или трехкратные определения.Средние, обозначенные звездочкой , отличаются от контрольных ( P <0,05).

    Рис. 4.

    Обнаружение STAT-1 (91 и 84 кДа), STAT-2 (113 кДа) и IRF-1 (37 кДа) в ядерных экстрактах клеток BEND с помощью вестерн-блоттинга. полоса, соответствующая 37 кДа форме IRF-1, показана стрелкой . Клетки BEND инкубировали в течение 0, 0,5 или 2 ч в отсутствие (C) или в присутствии 25 нм rbIFN-α (A) или rbIFN-τ (T). Ядерные экстракты выделяли, разделяли (4 мкг) на SDS-полиакриламиде (7.5%) гели, перенесенные на нитроцеллюлозу и обнаруженные с помощью антисывороток против STAT-1, STAT-2 или IRF-1. Вестерн-блоты количественно оценивали с помощью денситометрии. Оптическую плотность анализировали с помощью защищенного t -теста. Панели B, C и D показывают количественное определение STAT-1, STAT-2 и IRF-1 соответственно. Все средства обработки представляют собой повторные или трехкратные определения. Средние, обозначенные звездочкой , отличаются от контрольных ( P <0,05).

    Антитело против IRF-1 было предварительно адсорбировано пептидом IRF-1, чтобы определить, являются ли белки, иммунореагирующие с антителом против IRF-1, иммуноспецифичными (рис.5А). Предварительная абсорбция антитела против IRF-1 пептидом IRF-1 блокировала Вестерн-блот-детекцию всех, кроме одной иммунореагирующей полосы. Это интерпретируется как означающее, что все, кроме одной, иммунореагирующей полосы иммунореагируют специфически с антителом против IRF-1 и могут представлять изоформы IRF-1. Неспособность заблокировать детекцию единственной полосы даже после предварительной адсорбции с использованием молярного избытка пептида 1:10 все еще интерпретируется как иммуноспецифическая реакция. Это связано с тем, что эта полоса не появляется, когда первичное антитело удаляется из реакции вестерн-блоттинга ( i.е. (контроль, чтобы определить, иммунореагирует ли вторичное антитело неспецифически).

    Рис. 5.

    Обнаружение IRF-1 является иммуноспецифическим (A), и для индукции IRF-1 требуется синтез белка (B) На панели A ядерные экстракты были собраны из клеток BEND через 2 часа культивирования с 25 нм rbIFN- τ. Белки загружали в одномерные гели PAGE и проводили вестерн-блоттинг, используя антисыворотку против IRF-1, которая была предварительно адсорбирована пептидом IRF-1 в молярных отношениях 1: 0, 1: 1 или 1:10.Показан контроль, в котором первичное антитело было удалено из реакции вестерн-блоттинга (-1 st ). На панели B ингибирование синтеза белка с использованием циклогексимида не влияло на индукцию STAT-1 и STAT-2, но подавляло индукцию IRF-1 с помощью rbIFN-τ. Ядерные экстракты собирали из клеток BEND, культивированных в отсутствие (C) или в присутствии (T) 25 нМ rbIFN-τ и в отсутствие (контроль) и в присутствии циклогексимида. STAT и IRF определяли с помощью вестерн-блоттинга, как описано на фиг.4.

    Рис. 5.

    Обнаружение IRF-1 является иммуноспецифическим (A), и для индукции IRF-1 требуется синтез белка (B) На панели A ядерные экстракты были собраны из клеток BEND через 2 часа культивирования с 25 нм rbIFN-τ. Белки загружали в одномерные гели PAGE и проводили вестерн-блоттинг, используя антисыворотку против IRF-1, которая была предварительно адсорбирована пептидом IRF-1 в молярных отношениях 1: 0, 1: 1 или 1:10. Показан контроль, в котором первичное антитело было удалено из реакции вестерн-блоттинга (-1 st ).На панели B ингибирование синтеза белка с использованием циклогексимида не влияло на индукцию STAT-1 и STAT-2, но подавляло индукцию IRF-1 с помощью rbIFN-τ. Ядерные экстракты собирали из клеток BEND, культивированных в отсутствие (C) или в присутствии (T) 25 нМ rbIFN-τ и в отсутствие (контроль) и в присутствии циклогексимида. STAT и IRF были обнаружены с помощью вестерн-блоттинга, как описано на рис. 4.

    Из-за временной природы IFN-τ индукции STAT с последующей индукцией IRF-1, был проведен эксперимент, чтобы определить, требуется ли активация этих факторов транскрипции. перевод новых белков.В этом эксперименте смесь ингибиторов протеазы была включена во все реагенты, пока готовились экстракты клеток BEND. Обработка клеток BEND 25 нм rbIFN-τ эффективно индуцировала STAT-1 и STAT-2 в течение 30 мин (фиг. 5B). IRF-1 проявлял признаки индукции через 1 час, но наиболее сильно индуцировался через 2 часа после обработки IFN-τ. Опять же, даже в присутствии ингибиторов протеаз несколько полос белка иммунореагировали с антисывороткой против IRF-1, что согласуется с результатами, представленными на рис.4. Антитело против IRF-2 не иммунореагировало с ядерными белками, собранными в указанные сроки. Обработка клеток BEND циклогексимидом не влияла на индукцию STAT-1 или STAT-2 IFN-τ. Однако обработка циклогексимидом ингибировала индукцию IRF-1 в ответ на IFN-τ. Мы интерпретируем эти данные как означающие, что STAT постоянно присутствуют и индуцируются посредством фосфорилирования, чтобы проникнуть в ядро ​​и взаимодействовать с элементами ответа на генах. Один из генов, индуцируемых STAT, — это ген IRF-1.

    Анализ сверхсдвига электрофоретической подвижности

    Инкубация ядерных экстрактов с антисывороткой против IRF-1 вызвала сверхсдвиг в структуре полос, который был наиболее выражен в ядерных белках клеток BEND, которые были собраны через 2 часа после обработки IFN-τ (рис. 6). Эти данные интерпретируются как означающие, что IRF-1 является одним из ядерных белков, который взаимодействует с ISRE гена bISG17 в ответ на IFN-τ. Поскольку обработка ядерных экстрактов неиммунной сывороткой не влияла на сдвиг полос, можно сделать вывод, что суперсмещенная полоса была специфичной для комплекса IRF-1 / ISRE, когда использовалось антитело против IRF-1.Попытки вызвать сверхсдвиг полос при использовании антисыворотки против STAT-1 и STAT-2 потерпели неудачу (не показано).

    Рис. 6.

    Анализ сверхсдвига электрофоретической подвижности ядерных экстрактов из клеток BEND, обработанных 25 нм rbIFN-τ. После начальной реакции связывания экстрактов с меченым ISRE добавляли антитело против IRF-1 человека и продолжали инкубацию. на дополнительные 15 мин. Связанные комплексы разделяли с помощью PAGE, гели сушили и рентгенографировали, как описано на рис.3. Нижняя стрелка указывает положение предполагаемого комплекса IRF-1 / ISRE; верхняя стрелка отмечает суперсмещенный комплекс антитело / IRF-1 / ISRE. Время культивирования указано на верхней части геля. Обозначены инкубации с неиммунным IgG (N) или с антителом против IRF-1 (I, иммунный).

    Рис. 6.

    Анализ сверхсдвига электрофоретической подвижности ядерных экстрактов из клеток BEND, обработанных 25 нм rbIFN-τ. После начальной реакции связывания экстрактов с меченым ISRE добавляли антитело против IRF-1 человека и проводили инкубацию. продолжалось еще 15 мин.Связанные комплексы разделяли с помощью PAGE, гели сушили и рентгенографировали, как описано на фиг. 3. Нижняя стрелка указывает положение предполагаемого комплекса IRF-1 / ISRE; верхняя стрелка отмечает суперсмещенный комплекс антитело / IRF-1 / ISRE. Время культивирования указано на верхней части геля. Обозначены инкубации с неиммунным IgG (N) или с антителом против IRF-1 (I, иммунный).

    Обсуждение

    IFN-τ индуцирует транскрипцию гена ISG17 (12) и конъюгацию ISG17 с цитозольными белками матки (10).ISG17 матки похож на hISG15 по структуре (11) и функции (10) в том, что оба являются гомологами убиквитина. На основе Саузерн-геномных блотов в настоящих экспериментах был идентифицирован один главный ген ISG17. Частота обнаружения гена ISG17 в геномной библиотеке крупного рогатого скота (, т.е. 1 на 1000000) подтверждает этот вывод. Другие второстепенные полосы гибридизации на Саузерн-геномных блотах могут представлять гены, которые связаны, но, вероятно, не являются генами убиквитина, поскольку зонд ISG17 не гибридизуется с мРНК убиквитина (12).Использование кДНК hISG15 в качестве зонда в саузерн-блотах бычьего генома и использование зонда кДНК bISG17 в геномных саузерн-блотах человека не удалось даже в условиях нестрогой гибридизации (не показаны).

    Поскольку был идентифицирован только один главный ген bISG17, похоже, что bISG17 является аналогом hISG15. Общая организация генов hISG15 и bISG17 одинакова. Оба гена содержат один интрон после кодона инициации. Кодирующие последовательности гена bISG17 идентичны описанным в кДНК (11).Наиболее значительным сохранением первичной структуры между bISG17 (11), hISG15 (14, 21) и убиквитином (22) являются С-концевые аминокислоты Leu-Arg-Gly-Gly, которые, как было показано, участвуют в конъюгации с внутриклеточными белки.

    Ген bISG17 кодирует уникальные аминокислоты по сравнению с hISG15. Во-первых, он, по-видимому, обрабатывается иначе, чем hISG15. Стоп-кодон (TAG) в bISG17 сразу следует за нуклеотидами, кодирующими Leu-Arg-Gly-Gly, давая зрелый белок размером 17 кДа.Напротив, hISG15 имеет стоп-кодон, расположенный ниже этой последовательности (14, 23). Пре-hISG15 (17 кДа) подвергается посттрансляционной модификации, которая удаляет С-концевые аминокислоты с образованием зрелого белка (15 кДа), заканчивающегося Leu-Arg-Gly-Gly (24, 25). Три цистеина существуют в bISG17 (11), по сравнению с одним цистеином в hISG15 (14). Если в bISG17 образуются дисульфидные мостики, они могут сильно влиять на функцию из-за совершенно другой третичной структуры по сравнению с hISG15.Присутствие свободной сульфгидрильной группы на нечетном Cys в bISG17 и на одиночном Cys в hISG15 также может взаимодействовать с белками-мишенями или образовывать гомологичные димеры.

    Промотор hISG15 содержит функциональный тандемный ISRE от -113 до-94 относительно кэп-сайта мРНК, но мало что известно о последовательностях, которые расположены выше этого тандемного ISRE (14). В настоящих экспериментах сайт кэпа мРНК в гене bISG17 был идентифицирован с использованием двух методов. ТАТА-бокс (ТАТТААА) был расположен в гене bISG17 в положении -29 от предполагаемого кэп-сайта.Промотор гена bISG17 был подобен промотору гена hISG15 при размещении консервативного тандемного ISRE в положении -92. Однако три дополнительных предполагаемых ISRE присутствовали в гене bISG17 в положениях -123, -332 и -525.

    IFN взаимодействуют с трансмембранными рецепторами, которые связаны с тирозинкиназами, такими как Jaks и Tyks. Помимо проявления предпочтения лиганда, рецепторы сортируют внутриклеточные ответы посредством активации Jaks и Tyks, которые затем фосфорилируют по крайней мере шесть факторов транскрипции STAT (17).Анализ сдвига подвижности в настоящих экспериментах показал, что ядерные белки, индуцированные rbIFN-τ, взаимодействуют с тандемным ISRE bISG17. Одна более медленно мигрирующая полоса была индуцирована rbIFN-τ.

    IFN-τ индуцировал появление STAT-1, STAT-2 и IRF-1 в ядерных белках, экстрагированных из клеток BEND. Ингибирующий фактор транскрипции IRF-2 не был обнаружен в ядерных экстрактах, собранных после обработки IFN-τ, время от времени исследованных в настоящем эксперименте. Временные отношения между появлением STAT-1 и STAT-2 (0.5 ч) и IRF-1 (2 ч) в клетках BEND согласуется с индукцией этих ядерных белков в других клетках другими IFN типа 1 (26–28). STAT активируются в течение нескольких минут после лечения IFN. Фосфорилирование цитоплазматических STAT инициирует транслокацию в ядро, образование транскрипционных комплексов и индукцию вторичных факторов транскрипции, называемых IRF. В настоящих экспериментах индукция IRF-1 блокировалась обработкой циклогексимидом, тогда как индукция STAT не затрагивалась.Таким образом, можно сделать вывод, что основная роль STAT заключается в индукции гена IRF-1, который затем через IRF-1 активирует ген bISG17.

    В настоящее время не существует доказательств того, что STATs взаимодействуют с bISG17 ISRE в клетках BEND. В настоящих экспериментах попытки суперсдвига комплексов STAT / ISRE с анти-STAT-антителами не увенчались успехом, даже когда использовались ядерные экстракты, собранные после культивирования в течение 0,5, 1 или 2 ч с IFN-τ (не показаны). Однако, поскольку STAT взаимодействуют с ДНК как гетеро- или гомодимеры, неизвестно, являются ли эпитопы, распознаваемые антителами, недоступными из-за образования димеров.Антитело против IRF-1 вызывало сверхсдвиг комплекса ядерного экстракта клеток BEND / ISRE, предполагая, что IRF-1 взаимодействует с bISG17 ISRE.

    Каждый член семейства IRF играет разные роли в различных системах, таких как регуляция роста клеток, передача сигнала, индуцированная цитокинами, ответ на патогены и гематопоэтическое развитие (29). Семейство IRF теперь состоит из 10 членов, которые включают IRF 1–7, фактор ISG 3γ, белок, связывающий консенсусную последовательность IFN, и вирусный IRF (29). МРНК IRF-7 существует как минимум в трех вариантах сплайсинга (30, 31).Индукция нескольких иммунореагирующих полос IRF-1 на вестерн-блоттинге в ответ на IFN-τ была неожиданной и новой находкой. Поскольку STAT проявляются в виде отдельных полос с соответствующими молекулярными массами, протеолиз, по-видимому, не происходит при приготовлении ядерных экстрактов. Несмотря на это, белки, которые иммунореагировали с антителом против IRF-1, присутствовали даже тогда, когда ядерные экстракты были изолированы в присутствии смеси ингибиторов протеаз. Наименьший сигнал иммунореагирующего IRF-1 соответствует ожидаемой молекулярной массе мыши и hIRF-1.Одиночная мРНК IRF-1 мыши размером 2 т.п.н. кодирует белок IRF-1 (37 кДа), не имеющий сайтов N-гликозилирования (32). Однако IRF-1 человека имеет восемь сайтов фосфорилирования CKII (29). Неоднородность фосфорилирования может объяснять верхние полосы M r , которые иммунореагировали с антителом против IRF-1. Предварительная абсорбция антитела против IRF-1 с использованием пептида IRF-1 эффективно блокировала обнаружение всех, кроме одной, иммунореагирующей полосы на Вестерн-блоттинге. Белки, обнаружение которых было заблокировано, вероятно, представляют собой изоформы IRF-1 или родственные IRF-1 белки.Единственная полоса, которая не была заблокирована преадсорбцией антитела с пептидом IRF-1, также представляет интерес, поскольку она иммунореагирует с антителом против IRF-1, отсутствует, когда вторичное антитело удалено, и индуцируется IFN-τ способом, который идентичны другим иммунореагирующим полосам.

    IRF-2 не обнаруживался в экстрактах клеток BEND через 0,5, 1 или 2 часа после обработки IFN-τ. IRF-2 считается антагонистом IRF-1, поскольку он является негативным регулятором генов, активируемых IRF-1 (29).Предположительно, IRF-2 действует как конкурентный антагонист, потому что он имеет ту же специфичность связывания ДНК, что и IRF-1, и конкурирует за тот же сайт связывания (33). Таким образом, было предложено, что ISG либо активируются, либо ингибируются в зависимости от отношения IRF-1 к IRF-2. В настоящих экспериментах соотношение этих двух факторов транскрипции способствует активации промотора bISG17 в течение исследованного времени.

    Был выделен один главный ген, кодирующий bISG17. Этот ген, вероятно, является аналогом гена hISG15, но он кодирует белок, который больше, чем hISG15, и содержит несколько мутаций в функциональных аминокислотных остатках.Было показано, что оба белка функционируют как гомологи убиквитина путем конъюгирования с цитозольными белками. Судьба белков, конъюгированных с bISG17, еще предстоит определить, но, возможно, не связана с быстрой деградацией через протеасомы. Промоторы для этих генов похожи, но здесь сообщается о наличии трех дополнительных предполагаемых ISRE в гене bISG17. То, что это функциональные ISRE, еще предстоит определить с помощью сайт-направленного мутагенеза и анализа делеций. Используя новую клеточную линию BEND, Вестерн-блоттинг и EMSA, мы продемонстрировали, что IFN-τ индуцирует фосфорилирование STAT-1 и STAT-2, которые затем индуцируют IRF-1.IRF-1 был вовлечен во взаимодействие с bISG17 ISRE посредством анализа сверхсдвига EMSA. Поскольку не было показано, что STAT взаимодействуют с этим ISRE, мы подозреваем, что IRF-1 является прямым активатором транскрипции гена bISG17. Прекращение передачи сигнала будет в центре внимания будущих экспериментов и может включать убиквитинирование STATs (34) и последующую индукцию IRF-2.

    Материалы и методы

    Материалы

    Эндонуклеазы рестрикции были получены от Promega Corp.(Мэдисон, Висконсин) или New England Biolabs, Inc. (Беверли, Массачусетс). Олигонуклеотиды для экспериментов по секвенированию и удлинению праймеров были синтезированы Life Technologies (Gaithersburg, MD). Радиоактивно меченые нуклеотиды были получены от New England Nuclear (Бостон, Массачусетс) или Amersham (Арлингтон-Хайтс, Иллинойс). Все остальные химические вещества были от Sigma Chemical Co. (Сент-Луис, Миссури) или Fisher Scientific (Питтсбург, Пенсильвания) и имели чистоту реагента или выше.

    Саузерн-блоттинг

    ДНК тимуса теленка (10 мкг) (Sigma Chemical Co.) был полностью расщеплен Bam HI, Eco RI, Hin dIII, Pst I, Sma I или Sac I. (40 мМ трис-ацетат, 1 мМ ЭДТА) и разделяли электрофоретически при 20 В в течение ночи. Фрагменты ДНК переносили на нейлоновые мембраны (0,2 мкм, Nytran +; Schleicher & Schuell, Inc., Keene, NH), сушили, фиксировали путем запекания при 80 ° C и гибридизовали с кДНК bISG17, меченной случайным праймером (11).Процедуры прегибридизации, гибридизации и промывки были идентичны описанным при скрининге геномной библиотеки крупного рогатого скота. Саузерн-блоты экспонировали на рентгеновской пленке (Fuji RX; Fisher Scientific) в течение 12 дней.

    Просмотр библиотеки

    Геномная библиотека крупного рогатого скота λGEM-11, сконструированная из ДНК сперматозоидов (Promega Corp.), была подвергнута скринингу (20) с использованием радиоактивно меченной кДНК bISG17 в качестве зонда (11). Приблизительно 10 6 бляшек высевали с Escherichia coli Y1090 из расчета 25000 бляшкообразующих единиц (БОЕ) на 150-миллиметровый планшет.Бляшки переносили на нейлоновые мембраны Biotrans (размер пор 0,45 мкм) (ICN Biomedicals, Inc.; Ирвин, Калифорния), денатурировали 0,5 н. NaOH и 1,5 м NaCl, нейтрализовали 0,5 м Трис-HCl (pH 7,5) и 1,5 мл. NaCl и дважды промывали 2 × SSC (где 1 × SSC — 0,15 м NaCl, 15 мМ цитрат натрия). Мембраны запекали (2 часа, 80 ° C), прегибридизовали (3 часа; 50% формамид, 5 × SSC, 0,05 м фосфат натрия, 5 × раствор Денхардта, 0,1% SDS, 0,1 мг / мл ДНК спермы лосося), гибридизовали (18 ч), промывали трижды (15 мин: 2 × SSC / 0.1% SDS, 1 × SSC / 0,1% SDS, 0,1 × SSC / 0,1% SDS) (42 ° C) и помещены на пленку Fuji RX (Fisher Scientific) на 24 часа. Выявлена ​​одна положительная бляшка.

    После двух раундов очистки бляшек фаг очищали с использованием системы очистки ДНК Wizard Lambda (Promega Corp.), и вставку вырезали путем расщепления с помощью Sac I. Было обнаружено, что вставка фага содержит внутренний Sac I. сайтов и дали два рестрикционных фрагмента, 2,0 и 3,4 т.п.н., которые реагировали с зондом кДНК bISG17 на Саузерн-блоттинге.Эти фрагменты очищали в геле и субклонировали в pBluescript SK (Stratagene; La Jolla, CA). Плазмиды, содержащие вставки размером 3,4 и 2,0 т.п.н., были обозначены как pDP7 и pDP8 соответственно.

    Секвенирование ДНК

    Дидезокси-секвенирование проводили со стандартными прямым и обратным праймерами M13 с использованием Sequenase (Amersham). Клон pDP7 содержал 3′-конец гена bISG17 из сайта Sac I, о котором известно, что он находится в положении 416 кДНК bISG17 (11).Этот клон секвенировали по сайту полиаденилирования. Клон pDP8 содержал нуклеотиды, расположенные выше положения 416 кДНК bISG17, и был полностью секвенирован с использованием вложенных делеций, созданных системой Erase-a-base (Promega Corp.), и четырех дополнительных праймеров в положениях -260, -160, 595 и 751 (относительно предполагаемого участка кэпа).

    Идентификация сайта кэпа мРНК с использованием удлинения праймера

    Эндометрий собирали у коровы на 18 день эстрального цикла (отрицательный контроль) и беременности.Этот день беременности был выбран для представления времени, в течение которого ген bISG17 транскрибируется на высоких уровнях (12). Тотальную РНК экстрагировали из ткани эндометрия с использованием реагента Tri (Molecular Research Center, Inc.; Цинциннати, Огайо), как описано ранее (12). РНК (20 мкг) объединяли с 10 5 имп / мин олигонуклеотидного праймера с концевой меткой (CACCATGGCCGTGGGTTCTGG), который был выбран так, чтобы концы на 15 оснований находились выше кодона инициации. Использовали два метода удлинения праймера. В первом, более продолжительном методе гибридизации (35), РНК и меченый на конце олигонуклеотид растворяли в 30 мкл гибридизационного буфера (3 м NaCl, 0.5 м HEPES, pH 7,5, 1 мМ EDTA), инкубировали при 85 ° C в течение 10 мин, а затем инкубировали в течение 8 ч при 30 ° C. После осаждения этанолом примированную РНК растворяли в 10 мМ Трис-HCl, pH 9,0, 50. мМ KCl, 1 мМ дезоксинуклеозидтрифосфаты, 10 мМ MgCl 2 и 40 ед. РНКзина (Promega Corp.). Добавляли обратную транскриптазу MMLV (вирус лейкемии Молони мыши) (200 ед., Gibco BRL; Bethesda, MD), и смесь инкубировали при 37 ° C в течение 1 часа. Добавляли рибонуклеазу (10 мкг; Promega Corp.) и ЭДТА (конечная концентрация 25 мМ) и инкубацию продолжали еще 30 мин.Продукт удлинения экстрагировали один раз фенол-хлороформ-изоамиловым спиртом (25: 24: 1), осаждали этанолом и растворяли в 10 мкл буфера для загрузки геля для секвенирования (10 мМ ЭДТА, 95% формамид, 0,1% бромфенолового синего, 0,1% ксилола. цианол). Образцы нагревали до 95 ° C в течение 5 мин.

    Во втором, более коротком методе гибридизации (36) осадок РНК / праймера растворяли в 10 мкл буфера, содержащего 50 мМ трис-HCl, pH 8,3, 50 мМ KCl, 1 мМ дезоксинуклеозидтрифосфаты, 10 мМ MgCl 2 , 10 мм дитиотреитол (ДТТ), 0.5 мМ спермидина, нагревают до 60 ° С в течение 20 мин, а затем охлаждают до комнатной температуры в течение 10 мин. Добавляли обратную транскриптазу MMLV (вирус лейкемии Молони мыши) (40,5 ед .; 6 мМ пирофосфат натрия) и смесь инкубировали при 37 ° C в течение 30 мин. Реакцию останавливали добавлением 20 мкл буфера для загрузки геля для секвенирования, как описано выше, и нагреванием до 90 ° C в течение 10 мин. Продукты удлинения праймера анализировали на 6% геле для секвенирования рядом с лестницей дидезокси-секвенирования для определения точной длины продуктов.

    Культура клеток

    Линия клеток эндометрия крупного рогатого скота, называемая клетками BEND (13), культивировалась в среде, состоящей из 40% MEM (Sigma Chemical Co.), 40% Ham’s F-12, 10% FCS (инактивированный нагреванием), 10% лошадиной сыворотки (инактивированный нагреванием). ), 1% ABAM (раствор антибиотика антимикотика, Sigma Chemical Co.) и инсулин (0,2 Ед / мл). Клетки (2 × 10 6 ) помещали в 75-см колбы 2 (Корнинг, Кембридж, Массачусетс) при 37 ° C и 5% CO 2 . После достижения приблизительно 90% слияния клетки культивировали с 0 или 25 нм rbIFN-τ или rbIFN-α в течение указанного времени в бессывороточной среде.При необходимости добавляли циклогексимид (50 мкг / мл) (37) и rbIFN-τ (25 нм).

    Ядерные экстракты

    Ядерные экстракты получали модификацией метода Saatcioglu et al. (38). По назначению коктейль ингибиторов протеазы (лейпептин, 0,6 Ед / мл; пепстатин, 1 Ед / мл; апротинин, 10 Ед / мл; фенилметилсульфонилфторид, 1 мМ; и ЭДТА, 1 мМ) добавляли ко всем буферам после первоначального сбора ячеек BEND. Культивируемые клетки BEND дважды промывали, собирали (4 ° C) в 10 мМ HEPES (pH 7.5) и гранулированный (1700 × г ). Осадки клеток ресуспендировали в 5 объемах 10 мМ HEPES (pH 7,5), инкубировали на льду в течение 10 минут и снова осаждали. Клетки ресуспендировали в 2 об. 3 мМ MgCl 2 , 1 мМ DTT, 25 мМ HEPES (pH 7,5), 0,3% (об. / Об.) NP40 и разбивали 15 взмахами в гомогенизаторе Даунса (плотный пестик). Гомогенат немедленно центрифугировали в течение 20 секунд в микроцентрифуге Eppendorf (Brinkman Instruments, Inc., Вестбери, штат Нью-Йорк) (12000 × г ). Неочищенную ядерную таблетку суспендировали в 2 об. 0.1 м KCl, 1 мМ DTT, 25 мМ HEPES, pH 7,5. Ядра лизировали добавлением 2 м KCl, достаточного для получения раствора 0,4 мл, и осторожно перемешивали при 4 ° C в течение 15 мин. Лизат доводили до 20% в глицерине (об. / Об.) И центрифугировали (12000 × г ) в течение 15 мин при 4 ° С. Концентрацию белка в супернатанте анализировали с помощью анализа Coomassie Blue (Bio-Rad Laboratories, Inc., Hercules, CA), аликвоты и хранение при -80 ° C.

    Emsa

    Ядерные экстракты (5 мкг) инкубировали приблизительно с 20000 имп / мин (20 фмоль) меченного по концам двухцепочечного олигонуклеотида ISRE (GGGAAAAGGAAACCGAAACT; на основе последовательности промотора bISG17) в присутствии 1 мкг поли (dI-dC ) · Поли (dI-dC) (Sigma Chemical Co.) в конечном объеме 10 мкл, как описано ранее (38). Реакции связывания завершали в 25 мМ HEPES, pH 7,5, 1 мМ EDTA, 0,7 мМ DTT, 100 мМ KCl и 10% глицерине при комнатной температуре в течение 10 мин. Образцы наслаивали на 6% полиакриламидные гели (соотношение акриламид / бисакриламид 19: 1) в буфере, состоящем из 20 мм Трис, 20 мм HEPES, 1 мм EDTA, pH 8,0, и подвергали электрофорезу при 100 В в течение 90 мин при комнатной температуре. Гели на короткое время фиксировали в 50% (об. / Об.) Этаноле, 7% (об. / Об.) Уксусной кислоте и переносили на бумагу 3MM (Whatman, Clifton, NJ), сушили и рентгенографировали.Для конкурентных экспериментов немеченый двухцепочечный ISRE добавляли к стандартной реакции связывания при приблизительно 1-, 10- и 100-кратном молярном избытке (0,03 пмоль, 0,3 пмоль и 3 пмоль) по сравнению с меченным 32 P ISRE.

    Для анализа суперсдвига на основе антител (39) все стандартные компоненты образца были объединены и инкубированы при комнатной температуре в течение 5 минут. Добавляли антитела против IRF-1, STAT-1 или STAT-2 (1 мкг, Santa Cruz Biotechnology, Inc., Санта-Крус, Калифорния) или неиммунный кроличий IgG (1 мкг), и инкубацию продолжали в течение дополнительного За 15 мин до того, как образцы были загружены в 4% неденатурирующие одномерные гели для ПААГ.

    Радиомаркировка зондов

    кДНК bISG17 для саузерн-блотов метили [α — 32 P] dCTP с использованием процедуры случайного праймера (Boehringer Mannheim, Indianapolis, IN). Олигонуклеотиды для анализов удлинения праймеров и сдвигов подвижности метили по концам [γ- 32 P] АТФ с помощью полинуклеотидкиназы с использованием стандартных процедур (35). Меченые по концам олигонуклеотиды для анализа сдвига подвижности отжигали с 10-кратным избытком комплементарной немеченой цепи, чтобы гарантировать, что вся метка содержится в двухцепочечной ДНК.

    Вестерн-блоттинг

    Вестерн-блоттинга проводили, как описано ранее (4, 7, 12). Ядерные экстракты (4 мкг на дорожку) разделяли на 7,5% SDS-полиакриламидных гелях, переносили на нитроцеллюлозу и детектировали с помощью первичных антител против человеческого STAT-1 (E-23), человеческого STAT-2 (C-20), человеческого IRF. -1 (C-20) или IRF-2 человека (C-19) (Santa Cruz Biotechnology, Inc.). Первичные антитела разводили до 1,0 мкг / нл. Второе антитело представляло собой конъюгат против щелочной фосфатазы IgG кролика (1: 5000; Promega Corp.).

    Предварительная абсорбция антител против IRF-1

    Ядерные экстракты получали из клеток BEND, которые инкубировали с 25 нМ rbIFN-τ в течение 2 часов. Экстрагированные белки разделяли с помощью одномерного PAGE и вестерн-блоттинга, как описано выше, с антителом против IRF-1, которое было предварительно адсорбировано (1 час, 25 ° C с 1: 0, 1: 1 или 1:10 молярным избытком IRF- 1 (Santa Cruz Biotechnology, Inc.). Контроль, в котором первичное антитело было удалено из реакции вестерн-блоттинга, был включен, чтобы определить, иммунореагирует ли второе детектирующее антитело неспецифически.

    Благодарности

    Авторы благодарят доктора А. Л. Хааса (Медицинский колледж Висконсина, Милуоки, Висконсин) за кДНК hISG15 и доктора Р. М. Робертса (Университет Миссури, Колумбия, Миссури) за рекомбинантные интерфероны.

    Это исследование было поддержано грантом NIH R29 HD-32475.

    Список литературы

    1

    Thatcher

    WW

    ,

    Meyer

    MD

    ,

    Danet-Desnoyers

    G

    1995

    Признание беременности матерью.

    J Reprod Fertil Suppl

    49

    :

    15

    28

    2

    Bazer

    FW

    ,

    Spencer

    TE

    ,

    Ott

    TL

    a

    сигнал распознавания беременности.

    Am J Reprod Immunol

    37

    :

    412

    420

    3

    Робертс

    RM

    ,

    Malathy

    PV

    ,

    Hansen

    TR

    000800080008

    K

    1990

    Секреторные продукты крупного рогатого скота conceptus, участвующие в распознавании беременности.

    J Anim Sci 68 [Дополнение 2]:

    28

    38

    4

    Godkin

    JD

    ,

    Smith

    SE

    ,

    Johnson

    RD

    ,

    Dore

    Роль интерферонов трофобластов в поддержании беременности на ранних сроках у жвачных животных.

    Am J Reprod Immunol

    37

    :

    137

    143

    5

    Hansen

    TR

    ,

    Austin

    KJ

    ,

    Perry

    DJ

    K

    K

    MG

    ,

    Johnson

    GA

    1999

    Механизм действия интерферона-τ в матке на ранних сроках беременности.

    J Reprod Fertil [Suppl 54], в печати

    6

    Austin

    KJ

    ,

    Ward

    SK

    ,

    Teixeira

    MG

    ,

    Dean

    VC

    ,

    Hansen

    TR

    1996

    Перекрестно-реактивный белок убиквитин высвобождается маткой крупного рогатого скота в ответ на интерферон на ранних сроках беременности.

    Biol Reprod

    54

    :

    600

    606

    7

    Hershko

    A

    ,

    Ciechanover

    A

    1992

    Система деградации белка.

    Annu Rev Biochem

    61

    :

    761

    807

    8

    Finley

    D

    ,

    Chau

    V

    1991

    Убиквитинирование.

    Annu Rev Cell Biol

    7

    :

    25

    69

    9

    Driscoll

    J

    ,

    Goldberg

    AL

    1990

    Протеасома (мультикат) является протеасомным компонентом 1500 -kDa протеолитический комплекс, который расщепляет убиквитин-конъюгированные белки.

    J Biol Chem

    265

    :

    4789

    4792

    10

    Johnson

    GA

    ,

    Austin

    KJ

    , Van

    Кирк

    EA

    TR

    Беременность и интерферон-τ индуцируют конъюгацию бычьего белка, перекрестно реагирующего на убиквитин, с цитозольными белками матки.

    Biol Reprod

    58

    :

    898

    904

    11

    Austin

    KJ

    ,

    Pru

    JK

    ,

    Hansen

    TR

    кодирование бинарной кислоты перекрестно-реактивный белок: сравнение с убиквитином и 15 кДа гомологом убиквитина.

    Эндокринная

    5

    :

    191

    197

    12

    Hansen

    TR

    ,

    Austin

    KJ

    ,

    Johnson

    GA

    перекрестная экспрессия белка

    1997 Транзитный ген

    в эндометрии крупного рогатого скота.

    Эндокринология

    138

    :

    5079

    5082

    13

    Staggs

    KL

    ,

    Austin

    KJ

    ,

    MG Johnson

    GA

    ,

    Dooley

    VA

    ,

    Hansen

    TR

    1998

    Комплексная индукция белков матки крупного рогатого скота интерфероном-τ.

    Biol Reprod

    59

    :

    293

    297

    14

    Рейх

    N

    ,

    Evans

    B

    ,

    Levy

    D

    Kn

    E

    , Darnell

    Jr

    JE

    1987

    Интерферон-индуцированная транскрипция гена, кодирующего белок 15 кДа, зависит от расположенного выше энхансерного элемента.

    Proc Natl Acad Sci USA

    84

    :

    6394

    6398

    15

    Леви

    D

    ,

    Larner

    A

    ,

    Chaudhuri

    A

    Jr

    JE

    1986

    Транскрипция, моделируемая интерфероном: выделение индуцибельного гена и идентификация его регуляторной области.

    Proc Natl Acad Sci USA

    83

    :

    8929

    8933

    16

    Pestka

    S

    ,

    Langer

    JA

    ,

    Zoon

    CE

    000

    KC

    1987

    Интерфероны и их действие.

    Annu Rev Biochem

    56

    :

    727

    777

    17

    Darnell

    Jr

    JE

    1997

    STAT и генное регулирование.

    Наука

    277

    :

    1630

    1635

    18

    Харада

    H

    ,

    Takahashi

    E

    ,

    Itoh

    S

    K

    ,

    Taniguchi

    T

    1994

    Структура и регуляция генов человеческого фактора регуляции интерферона 1 (IRF-1) и IRF-2: значение для генной сети в системе интерферона.

    Mol Cell Biol

    14

    :

    1500

    1509

    19

    Lowe

    J

    ,

    Mcdermott

    H

    ,

    Loeb

    K

    as

    as

    Landon

    AL

    ,

    Mayer

    RJ

    1995

    Иммуногистохимическая локализация перекрестно-реактивного белка убиквитина в тканях человека.

    J Pathol

    177

    :

    163

    169

    20

    Hansen

    TR

    ,

    Leaman

    DW

    ,

    Cross

    JC

    ,

    Mathial

    Mathial JA

    Roberts

    RM

    1991

    Гены интерферонов трофобласта и родственного интерферона αII обладают отдельными 5′-промоторными и 3′-фланкирующими последовательностями.

    J Biol Chem

    266

    :

    3060

    3066

    21

    Нарасимхан

    J

    ,

    Potter

    JL

    ,

    Haas

    kon

    Гомолог убиквитина, индуцированный интерфероном, отличается от гомолога убиквитина.

    J Biol Chem

    271

    :

    324

    330

    22

    Wilkinson

    KD

    ,

    Audhya

    TK

    1981

    -зависимый протеин Стимуляция АТ последовательность Arg-Gly-Gly.

    J Biol Chem

    256

    :

    9235

    9241

    23

    Blomstrom

    DC

    ,

    Fahey

    D

    ,

    Kutny

    R 9000rrant8,

    E

    1986

    Молекулярная характеристика индуцированного интерфероном белка массой 15 кДа.

    J Biol Chem

    261

    :

    8811

    8816

    24

    Feltham

    N

    , Hillman

    Jr

    M

    ,

    Cordova

    B

    ,

    B Fahey,

    B

    ,

    Blomstrom

    D

    , Knight

    Jr

    E

    1989

    Интерферон-индуцированный белок массой 15 кДа и его предшественник 17 кДа: экспрессия в Escherichia coli, и характеристика, очистка , .

    J Интерферон Res

    9

    :

    493

    507

    25

    Knight

    Jr

    E

    ,

    Fahey

    D

    ,

    Cordova

    0003 B

    ,

    ,

    B

    ,

    Cordova

    R

    ,

    Reich

    N

    ,

    Blomstrom

    D

    1988

    Интерферон-индуцированный белок массой 15 кДа получают с помощью COOH-концевого процессинга предшественника 17 кДа.

    J Biol Chem

    263

    :

    4520

    4522

    26

    Бинелли

    M

    ,

    Subramaniam

    PS

    ,

    Thatcher

    Промоутеры WW

    фосфорилирование белка STAT-1 в эндометрии.

    Biol Reprod 54 [Suppl 1]: 450

    (Аннотация) 27

    Binelli

    M

    ,

    Diaz

    T

    ,

    Hansen

    TR

    ,

    Thatcher

    WW

    интерферон-τ индуцирует фосфорилирование и ядерную транслокацию STAT-1, -2 и -3 в эпителиальных клетках эндометрия.

    Biol Reprod 58 [Suppl 1]: 214

    (Abstract) 28

    Spencer

    TE

    ,

    Ott

    TL

    ,

    Bazer

    FW

    1998

    Нормативные факторы экспрессии в эндометрии овцы: влияние беременности и интерферона овцы τ.

    Biol Reprod

    58

    :

    1154

    1162

    29

    Nguyen

    H

    ,

    Hiscott

    J

    ,

    Pitha

    Interval .

    Cytokine Growth Factor Rev

    8

    :

    293

    312

    30

    Zhang

    L

    ,

    Pagano

    JS

    1997

    70003 новый регуляторный фактор IRF -Вирусная задержка Барра.

    Mol Cell Biol

    17

    :

    5748

    5757

    31

    Au

    WC

    ,

    Moore

    PA

    ,

    LaFleur

    DW

    ,

    ha

    PM

    1998

    Характеристика фактора регуляции интерферона-7 и его потенциальная роль в активации транскрипции генов интерферона А.

    J Biol Chem

    273

    :

    29210

    29217

    32

    Миямото

    M

    ,

    Fujita

    T

    ,

    Кимура

    Marara

    H

    ,

    Sudo

    Y

    ,

    Miyata

    T

    ,

    Taniguchi

    T

    1988

    Регулируемая экспрессия гена, кодирующего ядерный фактор IRF-1, который специфически связывается с IFN-β. генные регуляторные элементы.

    Cell

    54

    :

    903

    913

    33

    Tanaka

    N

    ,

    Kawakami

    T

    ,

    Taniguchi

    T

    регуляторных последовательностей (IRF-1) и IRF-2, регуляторы роста клеток и интерфероновой системы.

    Mol Cell Biol

    13

    :

    4531

    4538

    34

    Kim

    TK

    ,

    Maniatis

    T

    1996

    Регулирование протеасома ST-γ интерфероном-γ-интерфероном путь.

    Science

    273

    :

    1717

    1719

    35

    Sambrook

    J

    ,

    Fritsch

    EF

    ,

    Maniatis

    T

    изд 2.

    Cold Spring Harbor Press

    ,

    Cold Spring Harbor, NY,

    pp

    7.79

    7.83

    36

    Doyle

    K

    1996

    Протоколы и руководство по применению

    , изд.3.

    Promega Corp, Madison, WI

    , pp

    310

    312

    37

    Waring

    P

    1990

    Фрагментация ДНК, индуцированная в макрофагах под действием глиотоксина, не требует синтеза белка и предшествует повышенному инозитолу. уровни трифосфата.

    J Biol Chem

    265

    :

    14476

    14480

    38

    Saatcioglu

    F

    ,

    Perry

    DJ

    ,

    Pasco

    ДНК-связывающая активность арилуглеводородного (Ah) рецептора: специфичность последовательности и требование Zn 2+ .

    J Biol Chem

    265

    :

    9251

    9258

    39

    Kristie

    TM

    ,

    Roizman

    B

    1986

    1 вирус герпеса, основной белок вируса герпеса стабильно и специфически связаны с промоторно-регуляторными доменами α-генов и некоторых других вирусных генов.

    Proc Natl Acad Sci USA

    83

    :

    3218

    3222

    Авторские права © 1999, Общество эндокринологов

    Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    % PDF-1.6 % 1 0 объект > эндобдж 5 0 obj > эндобдж 2 0 obj > / Шрифт> >> / Поля [] >> эндобдж 3 0 obj > поток 2016-11-08T15: 38: 40 + 01: 002016-11-08T15: 38: 34 + 01: 002016-11-08T15: 38: 40 + 01: 00Adobe InDesign CS5 (7.0.4) application / pdfuuid: 00e4c596-6493-4271-bdd5-d175b255130fuuid: 9343ebbd-bfb7-430e-8b90-2f80da060c41 Adobe PDF Library 9.9 конечный поток эндобдж 4 0 obj > эндобдж 6 0 obj > эндобдж 7 0 объект > эндобдж 8 0 объект > эндобдж 9 0 объект > эндобдж 10 0 obj > эндобдж 11 0 объект > эндобдж 12 0 объект > эндобдж 13 0 объект > / XObject> >> / Аннотации [39 0 R] / Родитель 9 0 R / MediaBox [0 0 595 842] >> эндобдж 14 0 объект > / Шрифт> / ProcSet [/ PDF / Text] >> / Повернуть 0 / TrimBox [0.0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 15 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 16 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 17 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 18 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0.0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 19 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 20 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / Свойства> / MC1> >> / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 21 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / Свойства> >> / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680.315] / Тип / Страница >> эндобдж 22 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 23 0 объект > / ExtGState> / Шрифт> / ProcSet [/ PDF / Text / ImageC / ImageI] / Свойства> >> / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 24 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 25 0 объект > / ExtGState> / Шрифт> / ProcSet [/ PDF / Text / ImageC / ImageI] / Свойства> >> / XObject> >> / Повернуть 0 / TrimBox [0.0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 26 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 27 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 28 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / Свойства> >> / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 29 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / Свойства> >> / XObject> >> / Повернуть 0 / TrimBox [0.0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 30 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 31 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 32 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 33 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0.0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 34 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 35 0 объект > / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / TrimBox [0,0 0,0 481,89 680,315] / Тип / Страница >> эндобдж 36 0 объект > поток xWMoF] 7ʵ

    Онлайн-заявки на экспортные сертификаты для пищевых продуктов

    Промышленность может запросить большинство типов экспортных сертификатов FDA на пищевые продукты через систему подачи заявок на экспортную сертификацию и отслеживания (CFSAN eCATS).CFSAN eCATS — одна из отраслевых систем FDA, доступная по адресу https://www.access.fda.gov. CFSAN eCATS имеет разные модули для разных типов экспортных сертификатов. Перейдите по ссылкам ниже, чтобы получить пошаговые инструкции по подаче заявки на экспортные сертификаты.

    Модуль CFSAN eCATS

    Industry может запросить «Сертификат для иностранного правительства» и «Сертификат экспортной пригодности» через модуль CFSAN eCATS. Эти сертификаты доступны для обычных продуктов питания, пищевых добавок, веществ, контактирующих с пищевыми продуктами, и детских смесей.

    Скачать пошаговые инструкции CFSAN eCATS
    PDF: 1.6MB

    Советы по полному применению через CFSAN eCATS

    FDA может обрабатывать полные заявки намного быстрее, чем заявки, по которым нам нужно запрашивать дополнительную уточняющую информацию. Вы можете ознакомиться со следующими советами, чтобы подать заявку полностью.

    • Все этикетки продуктов и сопроводительная документация должны быть на английском языке или сопровождаться английским переводом.
    • Между производителем и товарами, указанными в заявке, должна быть четкая связь. Если этикетка продукта не включает название и адрес производителя, вы можете загрузить подтверждающую документацию через раздел «Дополнительные документы», чтобы продемонстрировать связь между продуктами и производителем (например, подписанное письмо производителя на фирменном бланке компании). .
    • Если производственное предприятие не проверялось FDA, вы можете загрузить отчет об инспекции из другого федерального, государственного или местного регулирующего органа через раздел «Дополнительные документы», чтобы продемонстрировать соответствие применимым U.С. требования.
    • Для пищевых добавок и веществ, контактирующих с пищевыми продуктами, если на этикетке продукта четко не указаны ингредиенты или вещества, используемые для производства конечного продукта, вы можете загрузить листы спецификаций или другую документацию через раздел «Дополнительные документы», чтобы продемонстрировать связь между продуктом.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *