Ифнс выписка онлайн: ЕГРЮЛ и ЕГРИП | ФНС России

Содержание

Выписка из ЕГРН налоговая. Проверка по ЕГРН на сайте налоговой

Получение налогового вычета за имущество требует предоставления документов на имущество. Что нужно знать о налоговой выписке из ЕГРН?

Когда требуется выписка из ЕГРН? Налоговая служба требует эту бумагу при совершении сделок с имуществом. Но как ее получить и что это за документ?

Выписка из ЕГРН для налогового вычета – для чего нужна

Для начала разберемся, для каких целей оформляется изучаемая документация.

Выписка из ЕГРН для налогового вычета необходима преимущественно при приобретении недвижимости. Возврат средств при продаже собственности тоже имеет место, но не всегда.

Выписка из ЕГРН налоговая — как выглядит

В любом случае, выписка из ЕГРН (налоговая) запрашивается,если:

— гражданин продал имущество или сдал его;

— произошла покупка недвижимости.

Представляют соответствующую справку об объекте недвижимости при подаче декларации о доходах или во время запроса вычета имущественного типа. Без причин ФНС не может требовать упомянутую бумагу.

Выписка из ЕГРН налоговая – содержание документа

Какие сведения можно увидеть в налоговой выписке из ЕГРН? Это самые обычные данные из реестра недвижимости. И они ничем не отличаются от общепринятых сведений из Госреестра.

То есть, в выписке из ЕГРН для налогового вычета собственник увидит:

— основание выдачи бумаги;

— характеристики недвижимости;

— Ф. И. О. собственников;

— наличие ограничений и обременений;

— сведения о регистрирующем органе.

Если запросить расширенный тип справки, можно дополнительно просмотреть историю перехода собственности от человека к человеку. Но ФНС подобной информацией почти не интересуется. Налоговой достаточно обычной выписки с характеристиками объекта. На ней мы остановимся более подробно.

Выписка из ЕГРН для налогового вычета – где можно запросить

Немаловажно понимать, где оформляется изучаемые бумаги. От этого будут зависеть дальнейшие действия по получению справки из реестра недвижимости РФ.

На сегодняшний день выписка из ЕГРН может быть получена в МФЦ.

Справка ЕГРН налоговая – как получить самостоятельно

Для начала рассмотрим алгоритм действий при запросе сведений из Госреестра лично. Это самый простой вариант развития событий.

Если собственность только приобретена, то с выданным при заключении сделки пакетом документов гражданин должен обратиться в один из регистрирующих органов. Спустя некоторое время, человеку выдадут справку установленного образца. В противном случае нужно подать запрос с документами, оплатить услугу и ждать.

После проделанных действий налоговая инспекция заберет у собственника выписку и учтет ее во время рассмотрения запроса по возврату средств за покупку недвижимости. Более подробную информацию по оформлению вычетов можно получить на сайте nalog.ru.

Справка ЕГРН налоговая – оформляем онлайн через Госреестр

В 2018 году в бумажном или электронном виде можно получить выписку из ЕГРН для налогового вычета в режиме онлайн. К примеру, через официальный сайт.

Налоговая выписка ЕГРН для юрлиц

Для того, чтобы подать запрос установленной формы, придется:

1. Зайти на сайт Росреестра.

2. Оформить запрос в электронном виде (заглянуть в «Сервисы»-«Сведения из ГКН»).

3. Оплатить услугу.

Сроки оказания услуги по заказу выписки ЕГРН

Как долго ожидать готовности изученной справки? Ответ зависит от способа подачи запроса.

Выписка из ЕГРН для налоговой с планом квартиры

Артемовцы впервые в этом году будут платить за недвижимость по ее кадастровой стоимости

К 1 ноября налоговая инспекция завершили подготовку и рассылку уведомлений на уплату имущественных налогов за 2020 год. Это налоги на недвижимое имущество, транспорт и землю.

Впервые в Свердловской области налог на недвижимость начислен по кадастровой стоимости. Раньше он рассчитывался по стоимости, определенной БТИ.  Заплатить налоги нужно до 1 декабря. Все они идут в бюджет.

Кто и за что платит

* Имущественный налог платят собственники недвижимости (ст. 400 НК РФ). Земельный — собственники земельных участков и лица, владеющие землей на праве постоянного (бессрочного) пользования, праве пожизненного наследуемого владения (ст. 388 НК РФ). За транспорт платят также его собственники (а не арендаторы и т.п.)

* Исчислять сумму для уплаты налогоплательщику самому не нужно, налоговый орган самостоятельно присылает квитанции с указанием суммы и срока оплаты.

* В этом году мы платим налоги за 2020 год. Если вы в этом текущем году, продали квартиру или машину, не удивляйтесь полновесной сумме начислений: недвижимость и транспорт были у вас в прошлом году, вот за это и нужно платить. За машину или квар­тиру, которые куплены в 2021 году, на­лог придет в следующем, 2022 году. 

Как отметила начальник отдела камеральных проверок Межрайонной ИФНС России № 23 Светлана Беляева:  “Обязанность налогоплательщика по уплате транспортного налога прекращается только с момента снятия транспортного средства (ТС) с регистрационного учета в ГИБДД. То есть, пока ТС не снято с учета в регистрирующих органах ГИБДД, плательщиком транспортного налога является формальный, а не фактический владелец автомобиля. Основания для прекращения взимания транспортного налога — угона ТС либо возникновение права на налоговую льготу. Договор купли-продажи — не основание для прекращения обязанности по уплате транспортного налога.”

* Уведомление с суммой налога может, как и раньше, прийти вам по почте. Но если вы заводили личный кабинет налогоплательщика на сайте ФНС, то уведомление не будут присылать в конверте и найти его можно будет лишь на сайте ИФНС. 

* При этом если вы придете в налоговую инспекцию и попросите распечатать уведомление — вам его распечатают (только имейте ввиду, что приема в налоговой инспекции Артемовского может не быть из-за коронавирусных ограничений).

* После 1 декабря на не уплаченные налоги будут начислять пени. Поэтому если уведомления нет в почтовом ящике или в личном кабинете — побеспокойтесь о его получении. “Мне не прислали, я ничего не получал, поэтому не заплатил”, — не оправдание для налоговиков. Нет уведомления — попросите его вам выслать.

* Если в налоговой инспекции нет сведений о каком-то вашем имуще­стве, то радоваться не стоит. “Молчуну” грозит штраф в размере 20% от неуплаченной суммы (ст. 129.1 п.3 Налогового кодекса РФ). Чтобы не было проблем, до конца 2021 года вам надо сообщить в налоговую инспекцию о каждом налогооблагаемом объекте: квартире, гараже, машине, участке. 

* Владение недвижимостью и транспортом нужно будет подтвердить с помощью копий правоустанавливающих доку­ментов. Сделать это можно, в част­ности, через многофункциональный центр (МФЦ). Не скрывайте недвижимость и авто: когда-то, возможно, придется их продавать и тут без выяснения ситуации с уплатой налога за них никак не обойтись.

Платим меньше или больше?

Налог на имущество — квар­тиры, дома, гаражи — впервые в области начислен только по кадастровой стоимости. Считается, что она приближена к реальной, рыночной. До этого налог начислялся по инвентаризационной стоимости — оценке БТИ. 

В последние годы в регионе (как и во всей стране, где раньше, а где позже) прошла переоценка земельных участков и недвижимости. У многих налог на недвижимость в этом году ощутимо выше, чем год назад. Это связано как раз с переоценкой недвижимости и касается, например, квартир в новых домах в центре города.

А у кого-то налог стал меньше: это опять же зависит от места, где стоит дом, его “возраста”.   

В первые три года налог по кадастровой стоимости рассчи­тывается с так называемыми пони­жающими коэффициентами, проще говоря, со скидкой. Самая боль­шая она у тех, кто платит первый год, что касается и нашей  Свердловской области. Дальше с каждым годом скидка уменьшается и сумма нало­га увеличивается.

Если есть сомнения по начисленным суммам, вопросы по налогам — обратитесь за разъяснениями в ИФНС лично или через форму обратной связи на сайте налоговой службы.

Земельный налог зависит  от оценки участка. Ее можно узнать, зака­зав в МФЦ или на сайте Росреестра выписку из Единого государствен­ного реестра недвижимости. В уве­домлении из налоговой инспекции кадастровая оценка тоже указана, но выписка по­зволит убедиться в правильности исходных данных для расчета налога.

Как обратиться в налоговую

1. Через «Личный кабинет налогоплательщика».
2. Лично прийти в налоговую инспекцию, записаться на прием заранее на удобное время можно через сайт order.nalog.ru. Не забудьте документ, удостоверяющий личность (паспорт).
3. Отправить письмо почтой на адрес ФНС или использовать сервис на сайте налоговой «Обратиться в ФНС России».

 Кому и за что платить не надо

1. По налогу на имущество есть достаточно длинный список федеральных льготников, самая мно­гочисленная категория из которых — пенсио­неры, информирует “Комсомольская правда”. Льготники пол­ностью освобождают­ся от налога на: 

— одну квартиру, 

— один жилой дом или часть жилого дома (да­ча тоже считается), 

— одну хозпостройку площадью до 50 кв. м, 

— один гараж или машино-место.

Не платить можно за все это имущество, ес­ли каждой его разно­видности у льготника по одно­му экземпляру: одна квартира, один дом, один гараж.

Но, например, у пенсионера есть в собственности одна квартира, жилой коттедж и дом в деревне. Тогда за квартиру он не платит, а за один из домов — либо коттедж, либо дом в деревне — платить при­дется (по умолчанию от налога освободят тот дом, который оценива­ется дороже). Две квар­тиры, и два гаража: льготник платит за одну квартиру и за один га­раж.

2. Аналогичные льготы, в том числе для пенсионе­ров, существуют по зе­мельному налогу — на шесть соток. Если уча­сток 10 соток — льгот­нику надо заплатить за 4 сотки. Если два участка по 6 соток — за один из них.

3. Кроме федеральных, есть регио­нальные льготы. Их особенно много по транспортному налогу. Уточнить их можно на сайте ФНС в разде­ле «Справочная инфор­мация о ставках и льго­тах по имущественным налогам».

Если вы льготник, но в уведомлении льгота не учтена, надо подать в любую удобную нало­говую заявление о том, чтобы ее предоставили.

По налогу на имущество физических лиц для расчета налога за 2020 год применяется кадастровая стоимость объектов недвижимости.

Теперь при расчете налога на имущество физических лиц предусмотрен вычет от кадастровой стоимости объекта недвижимости: 

* 50 кв.м. — для жилых домов; 

* 20 кв.м. — для квартиры/части жилого дома; 

* 10 кв.м. — для комнаты/части квартиры. 

Таким образом, если общая площадь меньше предусмотренного для вида объекта вычета, например — жилой дом общей площадью всего 35 кв.м., то налоговая база уменьшается до нуля, и налог за такие объекты не может быть исчислен, соответственно, в налоговом уведомлении они отсутствуют.

Налоговым кодексом РФ также предусмотрен вычет для физических лиц, имеющих трех и более несовершеннолетних детей. Это 5 кв.м для квартиры/комнаты; 7 кв.м — для жилого дома/части жилого дома, в расчете на каждого несовершеннолетнего ребенка. 

Вычет предоставляется в отношении одного объекта налогообложения каждого вида (квартира, комната, жилой дом, часть жилого дома). Вычет для физических лиц, имеющих трех и более несовершеннолетних детей, инспекцией предоставлен автоматически, на основании сведений, представленных органами социальной защиты населения.

 Как заплатить налоги

Через “Личный кабинет налогоплательщика”, (если он зарегистрирован) в разделе “Мои налоги”;
С помощью обновленного сервиса “Уплата налогов и пошлин” на сайте ФНС России;
Через сервис “Уплата имущественных налогов физических лиц и НДФЛ по индексу документа” на официальном сайте ФНС России.
В отделении банка либо через мобильное приложение банка по QR — коду в налоговом уведомлении.

Если у налогоплательщика нет времени для посещения налогового органа для получения доступа к личному кабинету, то можно использовать подтвержденную учетную запись Портала государственных услуг РФ. 

Возможность подтвердить учетную запись портала Госуслуг онлайн (без посещения уполномоченных центров регистрации) предоставляют своим клиентам банки: Сбербанк, Тинькофф Банк, Почта Банк, Банк ВТБ, СКБ Банк и некоторые другие.

 

 

Хочешь узнать, какая погода — посмотри, сколько друзей онлайн. Представляем прогноз на 10 ноября в Воронеже

Доброе утро всем и каждому! Представляем всю важную информацию о сегодняшнем дне.
Сегодня 10 ноября, погода 0°C. Ясно, ветер слабый, северо-западный 3.5 м/с. Атмосферное давление 762 мм рт. ст. Относительная влажность воздуха 55%.
Завтра ночью температура воздуха понизится до -3°C, ветер изменится на юго-западный 2.5 м/с. Давление останется без изменений 762 мм рт. ст. Температура днем, не поднимется выше отметки +3°C, a ночью 12 ноября не опустится ниже +1°C. Ветер будет юго-западный в пределах 4.7 м/с.
Восход: 07:32 Заход: 16:41 Долгота дня: 9 ч. 9 мин.

Сегодня именины отмечают

Мужчины

Арсений от древнегреческого имени Арсениос, происходящее от слова арсен — «мужественный, зрелый»
Георгий от древнегреческого имени Георгиос, происходящее от георгос — «земледелец», «возделывающий землю»
Дмитрий от древнегреческого имени Деметриос — «посвящённый Деметре (богине плодородия)», «земледелец»
Егор русский вариант древнегреческого имени Георгий — «земледелец», «возделывающий землю»
Иван от древнееврейского имени Йоханан — «Яхве милостив» от древнеиудейского Иоанн — «помилованный Богом»
Максим от римского родового имени Maximus — «величайший»
Николай от древнегреческого имени Николаос — «победитель народов»
Степан от древнегреческого имени Стефанос — «венок, венец», «корона»
Эммануил от древнееврейского имени Иммануэль — «с нами Бог»

Женщины

Анна от древнееврейского имени Ханна — «милость», «благодать», «сила», «храбрость»
Неонила от латинского имени Neonilla, происходящего от древнегреческого мужского имени Неон (от неос) — «молодая», «новая», «юная», «свежая»
Прасковья от древнегреческого имени Параскеве — «ожидание», «приготовление», «канун субботнего праздника (пятница)»
Феврония от греческого имени Феврониа, произошедшего от древнегреческого слова «фойбос» — «ясная», «светлая», «лучезарная» или от латинского «faber» — «ремесленник»

Праздники сегодня
Всемирный день науки за мир и развитие
День сотрудника органов внутренних дел Российской Федерации
Международный день бухгалтерии (День бухгалтера)
Всемирный день молодежи
Параскевы Льняницы.

События и памятные даты:
1444 — битва при Варне: крестоносцы потерпели поражение от турок,
1775 — Второй Континентальный конгресс принял решение о создании Континентальной морской пехоты,
1862 — премьера оперы Д. Верди «Сила судьбы» на петербургской сцене,
1864 — австрийский эрцгерцог Максимилиан провозглашён императором Мексики,
1871 — журналист Генри Стэнли обнаружил затерявшегося в Центральной Африке заболевшего шотландского исследователя Дэвида Ливингстона,
1881 — государство Эль-Мукалла было присоединено государством Эш-Шихр, и объединённое государство стало называться Эш-Шихр-Эль-Мукалла (с 1902 Султанат Шихра и Мукаллы; территория современного Йемена). Город Эль-Мукалла стал столицей государства до 1967 года,
1885 — Немецкие инженеры Готлиб Даймлер и Вильгельм Майбах установили разработанный ими двигатель внутреннего сгорания на деревянный велосипед, который совершает в этот день свою первую поездку,
1885 — Окончание экспедиции Н. М. Пржевальского в Центральную Азию, в том числе в северный Тибет,
1890 — британский крейсер «Serpent» выбросило штормом на скалы у побережья Испании. Погибли 167 человек.

Лучшие банки для иностранцев в Испании

Для того, чтобы нерезиденту открыть счет или взять ипотеку в Испании, необходимо собрать определенный пакет документов. Все документы должны быть переведены на испанский язык и заверены. Ознакомиться со списком и узнать о возможных способах заверения можно в статье «Открытие счетов в банках Испании». Стоит отметить, что точный перечень документов предоставляет конкретный банк в момент обращения.

Мы советуем пользоваться услугами банков-лидеров Sabadell, Santander или BBVA. Во-первых, это одни из самых крупных и надежных банков Испании. Во-вторых, Sabadell, Santander и BBVA активно сотрудничают с иностранцами, что подтверждают и специалисты «Дипломат-Консалтинг», исходя из своего опыта работы.

Компания «Дипломат-Консалтинг» оказывает содействие в открытии счетов в центральном офисе испанского банка Sabadell в Барселоне. Узнать подробнее об услуге можно по телефону +7 (495) 545-70-87 или по электронной почте [email protected] Также можно оставить заявку по кнопке ниже в форме обратной связи.

Оставить заявку

 

При наличии возможности рекомендуем сервис для клиентов с высоким уровнем дохода – Private Banking. Входной порог начинается с 1 миллиона евро. Эта услуга представляет собой персональное обслуживание, которое включает в себя все возможности банка недоступные обычным клиентам и индивидуального специалиста, который на связи 24 часа в сутки. 

Также упростить процедуру открытия банковского счета могут Ваши друзья или родственники, обладающие хорошей репутацией в данном отделении. Если посетить банк вместе, то шансы увеличиваются в несколько раз. Личный контакт и взаимная симпатия играют большую роль в данном процессе.

Список наиболее популярных банков в Испании среди иностранцев

 
Santander

Santander – крупнейший банк Испании и один из самых влиятельных игроков на мировом финансовом рынке. Поддержка, обслуживание и веб-сайт доступны только на испанском и каталонском языках, поэтому при попытке оформления счета в режиме онлайн потребуется знание языка. Для студентов и бизнеса банком разработаны специальные счета. Среди преимуществ клиенты отмечают выгодные банковские переводы и низкую комиссию за снятие наличных с других банкоматов.

Официальный сайт банка Santander на испанском языке: bancosantander.es 

 

BBVA

BBVA также является одним из самых крупных и популярных банков в Испании. Веб-сайт переведен на английский язык, что может стать одним из решающих факторов для тех, кто не владеет испанским языком. Счет можно открыть без затруднений в режиме онлайн, однако все документы необходимо принести непосредственно в офис банка. У BBVA есть мобильное приложение и офисы по всей Испании.

Личный опыт
На протяжении 10 лет жил в Испании и был клиентом данного банка. В целом BBVA проявил себя как надежный банк, который с легкостью одобрил и предоставил кредит. 

Официальный сайт банка BBVA на испанском языке: bbva.es

Официальный сайт банка BBVA на английском языке: bbva.es/eng/ 

 

Sabadell

Sabadell Bank – один из самых популярных банков среди иностранцев. Среди преимуществ отметим круглосуточную поддержку и банкоматы не только на испанском, но и на английском языке. В целях безопасности банк перестал использовать трехзначный CCV код на обратной стороне карты для покупок в Интернете, теперь проверочный код пользователи получают через удобное мобильное приложение. Онлайн-банкинг развит на высоком уровне, в приложении Вы можете отслеживать все свои транзакции и текущее состояние своего счета. 

Личный опыт
Устроилась на оплачиваемую стажировку, будучи студенткой в Испании. Для начисления зарплаты потребовалось открыть счет. Никаких проблем не возникло даже с моим средним знанием испанского, предоставила NIE, документы из университета и с работы. Кстати, для молодых людей от 18 до 25 лет не предусмотрены комиссии и дополнительные сборы за обслуживание, что было приятным бонусом.

Официальный сайт банка Sabadell на испанском языке: bancsabadell.com

Официальный сайт банка Sabadell на английском языке: bancsabadell.com/en/ 

 

CaixaBank

CaixaBank входит в «большую тройку» испанских банков (после Santander и BBVA), его филиалы и банкоматы встречаются буквально «на каждом шагу». Международным клиентам с интересами в Испании банк предлагает продукты и услуги, адаптированные к их потребностям. 

Официальный сайт банка CaixaBank на испанском языке: caixabank.es

Официальный сайт банка CaixaBank на английском языке: caixabank.es/en/ 

 

Bankia

Bankia входит в ТОП-5 банков по суммарному объему активов. Счет можно открыть в режиме онлайн, затем необходимо прийти в офис к финансовому консультанту банка. Вы найдете множество отделений не только в Испании, но и в некоторых странах Европы, а также в США и Китае. 

Официальный сайт банка Bankia на испанском языке: bankia.com/es/ 

Официальный сайт банка Bankia на английском языке: bankia.com/en/ 

 

Bankinter

Bankinter был основан в 1965 году и пользуется популярностью среди иностранцев. Клиентам особенно нравится, что банк идет в ногу со временем. Отдельно отмечается удобство пользования онлайн-банкингом и другими современными сервисами.

Официальный сайт банка Bankinter на испанском языке: bankinter.com

Официальный сайт банка Bankinter на английском языке: bankinter.com/en/ 

 

ING

ING Bank – голландский банк и по совместительству лучший банк Испании по версии Brand Finance за 2018 год. По мнению исследователей качество обслуживания и многолетняя «верность» также влияют на рейтинг. Банковский счет можно открыть в режиме онлайн на официальном сайте на испанском языке, англоязычная версия отсутствует. Небольшое количество офисов нисколько не смущает клиентов из-за хорошо развитой системы онлайн-банкинга.

Официальный сайт банка ING Bank на испанском языке: ing.es 

 

Deutsche Bank

Deutsche Bank – немецкий банк, один из крупнейших в Европе. Более 230 офисов расположено в Испании в 17 автономных сообществах. Банк работает с универсальными банковскими продуктами, предлагает обширный перечень финансовых услуг и программ, а также предоставляет услугу по управлению активами для частных клиентов.

Официальный сайт банка Deutsche Bank на испанском языке: db.com/spain/ 

Официальный сайт банка Deutsche Bank на английском языке: db.com/spain/en/ 

 

Этический банкинг в Испании


В Испании набирает популярность «этический банкинг», целью которого является вклад в развитие общества и сохранение окружающей среды. Клиенты таких банков обладают полной информацией о том, какие проекты финансируются посредством их сбережений. Инвестиции этического банка прозрачны. Вероятно, Вас заинтересует открытие счета именно в одном из подобных банков, и поэтому мы составили список этических банковских организаций в Испании.
 

 

Fiare Banca Etica

Fiare Banca Etica – банк появился вследствие слияния двух организаций Banca Popolare Etica и Fiare, деятельность которых была основана на этическом финансировании. 

Официальный сайт банка Fiare Banca Etica на испанском языке: fiarebancaetica.coop 

 

Triodos Bank

Triodos Bank – банк был основан в Голландии в 1980 году. В центре деятельности стоит улучшение благосостояния населения и забота об окружающей среде.

Официальный сайт банка Triodos Bank на испанском языке: triodos.es 

 

Coop 57

Coop 57 финансирует социально-значимые проекты. Частные лица и организации, являющиеся клиентами, полностью разделяют философию компании и следуют сформированным принципам. 

Официальный сайт банка Coop 57 на испанском языке: coop57.coop 

 

Oikocredit

Oikocredit – организация была основана в 1975 году в Голландии. Известна тем, что финансирует проекты в развивающихся странах и сконцентрирована на борьбе с бедностью. Девиз компании: «Инвестируйте в людей».

Официальный сайт банка Oikocredit на испанском языке: oikocredit.es 

Роль интерферонов типа I в гриппе: противовирусные супергерои или иммунопатогенные злодеи? — FullText — Журнал врожденного иммунитета 2020, Vol. 12, № 6

Аннотация

Важная роль интерферонов (IFN) в противовирусной защите врожденного иммунитета хорошо известна. Хотя рекомбинантный IFN-α был одобрен для лечения рака и хронических вирусных инфекций регулирующими органами многих стран, начиная с 1986 г., IFNs не одобрены для лечения инфекции, вызванной вирусом гриппа A (IAV).Частично это связано с комплексным действием интерферонов при острой гриппозной инфекции. IAV атакует респираторную систему человека и вызывает значительную заболеваемость и смертность во всем мире. Во время инфекции гриппа, в зависимости от штамма IAV и отдельного хозяина, IFN типа I могут оказывать защитное противовирусное действие или вносить вклад в иммунопатологию. В контексте вирусной инфекции иммунная система имеет сложные механизмы, регулирующие экспрессию и эффекты IFN типа I, чтобы максимизировать противовирусный ответ за счет как активации, так и усиления полезной функции врожденных клеток, ограничивая при этом иммунопатологические ответы, которые приводят к преувеличенному повреждению тканей.В этом обзоре мы суммируем сложную, но важную роль IFN типа I в инфекциях гриппа. Это включает как защитные, так и вредные эффекты этих важных цитокинов во время инфекции.

© 2020 Автор (ы) Опубликовано S. Karger AG, Базель


Введение

Вирус гриппа A (IAV) является членом семейства Orthomyxoviridae и представляет собой оболочечный вирус с отрицательной цепью РНК, вызывающий значительную заболеваемость и смертность во всем мире.Эпителиальные клетки верхних дыхательных путей являются основными мишенями IAV после преодоления местных защитных сил, включая слизистую, содержащую сиаловую кислоту, в эпителиальной выстилочной жидкости. В то время как вирус реплицируется в эпителиальных клетках, вирус также распространяется на непермиссивные иммунные клетки, такие как макрофаги и дендритные клетки (ДК), в дыхательных путях легких [1, 2]. В этих инфицированных клетках вирус распознается 3 семействами рецепторов распознавания образов (PRR): Toll-подобными рецепторами (TLR), RIG-I-подобными геликазами (RLR) и нуклеотид-связывающим доменом и белками, содержащими богатые лейцином повторы. (NLR).Распознавание и связывание вирус-специфических нуклеиновых кислот с помощью PRR вызывает продукцию и секрецию интерферонов (IFN) и провоспалительных цитокинов, которые являются критическими компонентами противовирусного ответа у млекопитающих. IFN являются основными цитокинами, экспрессируемыми во время ответа хозяина, с противовирусным, антипролиферативным и иммуномодулирующим действием на вирусную или бактериальную инфекцию. Помимо их роли в ограничении инфекции, IFN также участвуют как в иммунном надзоре за раком, так и в аутоиммунной системе [3, 4].

IFN могут продуцироваться практически всеми ядросодержащими клетками позвоночных и классифицируются как IFN типа I, типа II или типа III в соответствии с их генетическими, структурными и функциональными характеристиками и специфическими рецепторами на поверхности клетки [5]. В 1957 году Линденманн и др. [6] открыли вещество, защищающее клетки от инфекции IAV, — они назвали его интерфероном [6]. У людей и мышей IFN типа I состоят из 19 белков IFN: 14 подтипов IFN-α (от IFN-α1 до α14), IFN-ω, IFN-, IFN-τ, IFN-κ и IFN-β.IFN-α и IFN-β могут экспрессироваться почти каждым типом клеток [7, 8]. Семейство IFN типа II представлено одним генным продуктом, IFN-γ, и в основном продуцируется Т-лимфоцитами и естественными киллерными (NK) клетками [9, 10]. IFN типа III включают 4 подтипа, IFN-λ1, IFN-λ2, IFN-λ3 и IFN-λ4, а также экспрессируются во множестве типов клеток [11, 12].

ИАВ являются сильными индукторами всех типов ИФН на различных стадиях инфекции [13]. В этом обзоре мы сосредоточимся на роли IFN типа I, индуцируемых во время инфекции IAV, поскольку врожденные и адаптивные иммунные ответы на IAV у млекопитающих в значительной степени зависят от IFN типа I.

Ингибирование IFN типа I репликации IAV

IFN типа I при инфицировании IAV стимулирует экспрессию сотен генов, известных как интерферон-стимулированные гены (ISG), которые действуют для уничтожения вируса и предотвращения его распространения путем стимулирования противовирусное состояние в соседних клетках (рис. 1). Все ISG демонстрируют одинаковую характерную структуру спиральных цитокинов с пучком из 4 α-спиралей, организованных в конфигурации «вверх-вверх-вниз-вниз», а также содержат дополнительную отдельную α-спираль [14].

Рис. 1.

Индукция IFN и ISG типа I вирусом гриппа. Врожденные иммунные клетки, такие как макрофаги и эпителиальные клетки легких, продуцируют IFN типа I после зондирования геномной РНК IAV с использованием различных PRR. В инфицированных и соседних клетках передача сигналов IFN типа I активирует путь JAK-STAT, приводя к транскрипции ISG, продукты которых инициируют внутриклеточные противовирусные эффекторы, ограничивающие распространение вирусов. ИФН, интерферон; ISG, IFN-стимулированный ген; PRR, рецептор распознавания образов; JAK, киназа Януса; STAT, преобразователь сигнала и активатор транскрипции; TLR, Toll-подобный рецептор; RLR, RIG-I like геликаза; NLR, нуклеотид-связывающий домен и белок, содержащий повторы с высоким содержанием лейцина.

Как секретируемые белки, IFN типа I действуют как межклеточные мессенджеры и оказывают сильные биологические эффекты при чрезвычайно низких концентрациях через рецептор IFN-α / β типа 1 (IFNAR), трансмембранный рецептор клеточной поверхности. IFNAR состоит из 2 субъединиц — IFNAR1 и IFNAR2. Обычно IFNAR подвергаются эндоцитозу и активируют связанные с ними тирозинкиназы Tyk2 и Jak1 [15] с последующим связыванием IFN типа I. Jak1 активирует преобразователь сигнала и активатор транскрипции (STAT) 1 путем фосфорилирования.Этот классический сигнальный каскад приводит к образованию IFN-стимулированного генного фактора 3 (ISGF3), комплекса фосфорилированных STAT1 и STAT2 с IRF9. Активация ISGF3 приводит к увеличению экспрессии более 100 ISG, включая 2 ‘, 5’-олигоаденилатсинтетазу (OAS), Mx белки, интерферон-индуцированный трансмембранный белок 3 (IFITM3) и протеинкиназу R (PKR), вызывая противовирусное состояние [16].

Роль IFN типа I в патогенезе IAV сложна. Например, у мышей, генетически лишенных передачи сигналов IFN типа I, клиренс IAV был неэффективным [17, 18].При профилактическом применении IFN типа I снижает репликацию IAV и тяжесть заболевания как у животных [19], так и у людей [20]. Вовлечение IFN-ответа типа I до инфицирования может быть терапевтической стратегией для контроля инфекции IAV в различных моделях животных, но, конечно, имеет ограниченное практическое применение [21, 22].

Эксперименты с заражением 2 различными штаммами IAV выявили значительное снижение выживаемости и повышение титров вируса в легких мышей с дефицитом IFN-β, демонстрируя, что IFN-β способствует врожденному иммунитету против IAV [18].Поскольку белок STAT1 необходим для передачи сигналов от IFN типа I, животные STAT1 — / — в 100 раз более чувствительны к летальной инфекции A / WSN / 33 (h2N1) IAV, чем их аналоги дикого типа (WT) [23]. Кроме того, как показано группой Гарсиа-Састре [23], LD 50 вируса IAV PR8 была в 10 раз ниже у мышей STAT1 — / -, чем у мышей WT. In vitro WSN33 реплицируется с высокими титрами в фибробластах STAT1 — / — или IFNAR — / -, тогда как клетки, полученные от животных WT, устойчивы к инфекции IAV [23]. Однако эти результаты не были напрямую переведены на модели in vivo с использованием IFNAR — / — мышей другими группами.Титры X31 (h4N2) IAV в легких IFNAR-дефицитных мышей существенно не отличались от контрольных WT, а IFNAR — / — и WT мыши были сравнительно восприимчивы к инфекции X31 [24].

Отличная работа Crotta et al. [25] позже объяснили очевидные противоречивые результаты с использованием мышей STAT1 — / — и IFNAR1 — / — во время инфекции IAV [25]. Разница, по-видимому, связана с разными типами эффектов IFN в эпителии легких мышей. IAV были более патогенными и реплицировались с более высокими титрами в легких мышей, лишенных как IFNAR, так и рецептора IFN-λ (IFNLR), чем у мышей с дефектами одного рецептора IFN.При использовании химерных мышей костного мозга с донорами WT и реципиентами с двойным дефицитом IFNAR1 / IFNLR отсутствие передачи сигналов IFN типа I и типа III в стромальном компартменте значительно увеличивало восприимчивость к инфекции гриппа. В частности, когда эти химеры были инфицированы IAV PR8, высокая чувствительность и смертность были обнаружены только в группе, лишенной рецепторов IFN на стромальных клетках, и это коррелировало с более высокими вирусными титрами [25]. Это исследование демонстрирует перекрывающуюся и потенциально компенсаторную функцию IFN типа I и типа III в контроле IAV, поскольку нокаут обоих рецепторов требуется для повышенной восприимчивости к IAV-инфекции.Поскольку активация STAT1 необходима для передачи сигналов через оба рецептора, нокаут STAT1 подавляет функцию путей передачи сигналов IFN как типа I, так и типа III. Таким образом, результаты с использованием химерных двойных нокаутов проясняют путаницу, возникшую из более ранней литературы, в которой сообщалось, что IFN типа I не могут сами по себе учитывать потребность в передаче сигналов STAT1 для защиты от инфекции IAV.

Дополнительные исследования показали, что в отличие от рецепторов IFN типа I, экспрессия функциональных комплексов рецепторов IFN-λ ограничена эпителиальными клетками легких и кишечника.Следовательно, эффекты IFN типа III могут быть ограничены борьбой с репликацией вируса на поверхности слизистых оболочек из-за ограниченной экспрессии рецепторов IFN-λ [11]. Передача сигналов IFN типа I более важна для ограничения распространения системной инфекции IAV из-за его универсального распределения во всех типах клеток. Эта парадигма эксклюзивного эпителиального действия IFN типа III недавно подверглась сомнению, поскольку другие клетки, такие как нейтрофилы и DC, также реагируют на IFN-λ [26]. С другой стороны, недавняя работа с IAV-инфицированными мышами [27] показала, что IFN-λ продуцируется быстрее, чем IFN типа I, предполагая, что IFN типа III играет неизбыточную роль в подавлении раннего роста вируса в дыхательных путях.IAV быстрее распространяется из носовой полости в легкие у мышей, чья система IFN типа III была дефектной. Инфекции у мышей, которым не хватало IFN типа III, также с большей вероятностью распространялись на других животных. Кроме того, лечение мышей IFN типа III, но не IFN типа I, обеспечивало длительную защиту их верхних дыхательных путей от инфекций гриппа и предотвращало распространение вируса [28]. Таким образом, IFN типа III составляет первую линию противовирусного невоспалительного ответа, в то время как IFN типа I может действовать как реагирующий агент второй линии, а также увеличивать продукцию воспалительных цитокинов в дополнение к противовирусным медиаторам.

IFN-индуцированное воспаление и повреждение тканей типа I

Помимо вышеуказанных противовирусных эффектов, данные также указывают на патогенную роль IFNs типа I во время вирусной инфекции. Во время хронической вирусной инфекции исследования in vivo выявили супрессивные механизмы, участвующие во вредных эффектах интерферонов I типа. Хроническая передача сигналов IFN связана с гипериммунной активацией и прогрессированием заболевания при стойких инфекциях [29]. Существует прямая причинно-следственная связь между передачей сигналов IFN, активацией иммунной системы, экспрессией отрицательного иммунного регулятора, дезорганизацией лимфоидной ткани и персистенцией вируса [30].Поскольку грипп в основном вызывает острую инфекцию, подробности пагубных последствий хронической вирусной инфекции здесь не рассматриваются.

При инфекции высокопатогенным штаммом IAV, таким как пандемический штамм h2N1 1918 г. и птичий штамм H5N1, IAV вызывает пневмонию у людей с прогрессированием до легочной недостаточности и летальным исходом. Обычно наблюдается прогрессирующая первичная вирусная пневмония, при этом вторичная бактериальная пневмония более заметна после вспышки пандемического вируса 1918 года, чем у людей, инфицированных H5N1 [31].Рекомбинантный IAV, несущий гликопротеины гемагглютинина (HA) и нейраминидазы (NA) вируса 1918 года, реконструировали на генетическом фоне штамма h2N1 человека (1918 HA / NA: Tx / 91). Хотя уровни IFN-α в легких были схожими для обеих групп, инфицированных вирусом, хемокины IFN-γ, TNF-α, MIP-1α и MIP-2 были обнаружены на значительно более высоких уровнях в 1918 г., инфицированных HA / NA: TX / 91. мышей, чем у мышей, инфицированных сезонным TX / 91 [32, 33]. Приматы, отличные от человека, инфицированные реконструированным пандемическим вирусом 1918 года, продемонстрировали дисрегулируемую экспрессию врожденного иммунного ответа, который может быть критическим детерминантом серьезности и исхода инфекции пандемическим вирусом 1918 года.Вирус 1918 г. вызывал противовирусный ответ, отличный от ответа на сезонный штамм h2N1 и менее защищающий его от вируса [34]. Инфекция вируса 1918 г. индуцировала гораздо меньше генов IFN-α, чем обычный вирус. МРНК IFN-β либо не индуцировалась, либо подавлялась во всех образцах вирусом 1918 года. Что касается вируса птичьего гриппа, исследования in vitro также продемонстрировали устойчивую индукцию провоспалительных цитокинов, в частности TNF-α и IFN типа I, вирусами H5N1 по сравнению с другими вирусами h4N2 и h2N1 человека [35].Другие исследования выявили сильную корреляцию между уровнями IL-6, IFN-α и TNF-α и тяжестью симптомов заболевания. Как и при экспериментальном гриппе, симптомы и лихорадка при естественном остром гриппе коррелируют с высвобождением IL-6 [36, 37].

В сезонном вирусе многие провоспалительные цитокины и хемокины также индуцируются ниже по ходу передачи сигналов IFNAR, что может вызывать усиленный воспалительный ответ и повреждение тканей. Одно раннее исследование показало, что местная респираторная продукция IFN-α у людей коррелирует с инфекцией и тяжестью заболевания [36].Было обнаружено, что главной детерминантой этого индуцированного IFN-β вредного ответа хозяина является мощный индуцирующий апоптоз рецептор смерти 5 (DR5), который функционирует как рецептор для индуцирующего апоптоз лиганда, связанного с фактором некроза опухоли (TRAIL), в пневмоцитах легких [ 38]. Было показано, что тяжелая инфекция IAV связана с TRAIL-опосредованным апоптозом при повреждении эпителия при вирусной пневмонии у мышей и людей [39, 40] и что IFN-α / β может индуцировать экспрессию TRAIL макрофагами, инфицированными IAV, и pDC [39, 41].

Более поздняя работа Davidson et al. [42] подтвердили, что чрезмерная передача сигналов IFN типа I в ответ на острую инфекцию IAV может привести к неконтролируемому воспалению [42]. Этот эффект, вероятно, связан с индукцией гибели эпителиальных клеток, вторичной по отношению к проапоптотическим эффектам IFN типа I. Более восприимчивые линии мышей продуцируют значительно более высокие уровни IFN в ответ на инфекцию гриппа, чем устойчивые линии. Большое количество гиперреактивных pDC продуцировало избыточные количества IFN, поддерживаемые с течением времени, что, в свою очередь, вызывало неконтролируемое воспаление и повреждение эпителия легких, опосредованное взаимодействиями TRAIL-DR5 [39].Уровень индукции экспрессии гена лиганда Fas (FasL) в легких также коррелировал с тяжестью инфекции гриппа, а IFN типа I имеет решающее значение для индукции экспрессии белка FasL в легких [43]. Благодаря этому механизму чрезмерное количество IFN типа I приводит к повреждению легких и смерти при тяжелой инфекции IAV.

Различные группы населения могут иметь специфический ответ на IFN типа I. Известно, что младенцы и дети младшего возраста имеют более высокий риск неблагоприятных клинических исходов после инфицирования IAV [44].Исследования обнаружили минимальное увеличение вирусной нагрузки у очень молодых людей и отсутствие связи возраста с существующим титром антител [45–47]. Вместо этого наблюдалась гораздо более заметная возрастная ассоциация с подмножествами цитокинов, включая IFN типа I [48]. Повышенные уровни IFN-α2 при промывании носа коррелировали с увеличением тяжести заболевания даже после учета факторов, связанных с возрастом [49]. Известно, что местные иммунные реакции дыхательных путей являются критическими детерминантами кинетики инфекции и прогрессирования заболевания.

Постинфекционное терапевтическое введение неэффективно в моделях на животных и может фактически увеличить летальность, несмотря на снижение титров IAV легких [19].Длительный или усиленный ответ IFN типа I на более поздних стадиях может ухудшить воспалительный ответ при пневмонии IAV [39]. Чтобы предотвратить сильные побочные эффекты провоспалительных функций IFN, множественные негативные регуляторные механизмы включают в себя широкий спектр молекул, которые действуют во всех точках сигнального пути IFN, чтобы контролировать продукцию IFN типа I, сигнальную трансдукцию и опосредованную IFN транскрипцию и трансляцию (обзор Порритта и Герцога [50]). Отрицательные регуляторные механизмы действуют для калибровки ответа IFN, позволяя избавиться от вируса при сохранении гомеостаза.IFN типа I опосредуют усиление экспрессии белков, индуцирующих апоптоз, экспрессируемых негематопоэтическими соматическими клетками, опосредующими повреждение тканей. Те же молекулы, когда они индуцируются в иммунных клетках IFN, могут способствовать иммуносупрессии аналогично PDL1 и IL-10. Следовательно, IFN типа I могут усиливать или уменьшать воспаление и патологию в зависимости от условий эксперимента. При оценке воздействия индукции IFN на клетку-хозяин или клетку-мишень необходимо учитывать такие факторы, как время, величина передачи сигналов, источник клеток и отдельные изучаемые подвиды IFN.

Иммунорегуляторные функции

В отличие от их провоспалительных эффектов, все больше данных свидетельствует о том, что IFN типа I обладают иммунорегуляторными функциями, которые имеют решающее значение для ослабления иммунопатогенных механизмов и минимизации побочного ущерба от инфекции [51]. Они вносят вклад в ключевую модуляцию противовирусных функций в DC, моноцитах, нейтрофилах, NK-клетках и T-клетках (рис. 2). Провоспалительные цитокины являются положительными медиаторами местного и системного воспаления, вызывают лихорадку, инициируют разрушение тканей и модулируют адаптивный иммунный ответ на IAV.Противовоспалительные цитокины уменьшают воспаление и способствуют заживлению. Чистый эффект воспалительной реакции определяется балансом между провоспалительными и противовоспалительными цитокинами. Сообщалось о про- и противовоспалительном действии на популяции клеток дыхательных путей после перорального или системного введения IFN-α мышам и лошадям [52–55].

Рис. 2.

IFN типа I модулируют функции иммунных клеток во время инфицирования вирусом гриппа. ИФН, интерферон; NK-клетка, естественная клетка-киллер; DC, дендритная клетка; IFNAR, рецептор IFN-α / β.

ДК представляют собой антигенпрезентирующие клетки (АРС), расположенные на порталах проникновения патогенов, которые имеют решающее значение для активации противовирусных Т-клеток [56]. Введение IFN типа I в ДК мыши и человека способствует созреванию ДК и усиливает экспрессию костимулирующих молекул и стимуляцию ДК Т-клеток [57, 58]. Simmons et al. [59] показали, что IFN типа I управляет отличительной программой созревания DC, которая усиливает презентацию антигена Т-клеткам без остановки процессинга антигена, что позволяет продолжать отбор образцов антигенов для презентации [59].Это может быть полезно в ходе инфекции IAV, поскольку некоторые DC могут подвергаться воздействию IFN до того, как они столкнутся с вирусом и антигенами, экспрессируемыми вирусом, и может быть важно избежать преждевременного прекращения обработки антигена до того, как DC подвергнутся воздействию патогенов. Однако некоторые результаты определяют противоположную роль IFN типа I в DC, инфицированных IAV. Сообщается, что IFN-αβ ингибирует in vitro дифференцировку DC от предшественников CD14 +. IFN типа I ингибировал дифференцировку гематопоэтических предшественников таким образом, что это привело к снижению продукции дендритных клеток костного мозга (BMDC) [60].Эти противоречивые результаты могут быть связаны с различными эффектами IFN типа I на активацию DC в зависимости от состояния созревания DC [61].

IFN типа I действует как главный регулятор, контролирующий, какое подмножество DC будет представлять антигены во время вирусной инфекции. Оба подмножества DC легких, CD103 + DC и CD11b high DC, инфицируются IAV in vivo и мигрируют в MLN, но только CD103 + DC поддерживают продуктивную репликацию вируса. Феномен возникает из-за разницы в чувствительности двух популяций DC к IFN I типа [62].CD103 + DC экспрессируют низкие уровни IFNAR по сравнению с другими подтипами DC и устойчивы к IFN типа I. Ослабленная передача сигналов IFNAR посредством CD103 + DC коррелирует с их способностью к внутренней вирусной репликации и повышенной способностью презентации антигена для наивных CD8 + T-клеток по сравнению с CD11b high DC. Это может быть связано с большей доступностью вирусного антигена в CD103 + DC. Представление о том, что мигрирующие CD103 + DC легкого являются пермиссивными для репликации вируса IAV, а IFN типа I повышают их способность как APC к CD8 + Т-клеткам, подверглись сомнению в более поздних исследованиях, показывающих (i) отсутствие репликации вируса в этой подгруппе во время инфекции in vivo [63 ] и (ii) инфекция DC не требуется для презентации антигена [64].CD103 + DC приобретают и транспортируют вирусные антигены из легких в дренирующие лимфатические узлы, где они способны как к прямой, так и к перекрестной презентации вирусных антигенов. Тем не менее Helft et al. [63] также наблюдали, что устойчивость CD103 + DC к инфекции коррелирует с повышенным антивирусным состоянием в этих клетках, которое зависит от экспрессии рецептора IFN типа I [63]. Эти результаты показывают, что эффективное перекрестное праймирование мигрирующими ДК легких связано с приобретением антивирусного состояния, которое зависит от сигнального пути IFN типа I.Интересно, что недавняя работа показала, что CD103 + DCs могут полагаться на передачу сигналов IFN-λ для оптимальной активации через рецептор IFN-λ [65]. Таким образом, хотя презентация антигена DC в легких пропорциональна репликации вируса и жестко ограничивается IFN типа I, для оптимальной активации DC, напротив, может потребоваться IFN III типа.

После инфицирования IAV вирус вызывает начальное высвобождение медиаторов воспаления, что приводит к острому воспалению легких, связанному с привлечением воспалительных моноцитов и нейтрофилов в инфицированных легких [31].Проточная цитометрия и анализ экспрессии генов с участием изолированных субпопуляций клеток из инфицированных легких показали, что приток нейтрофилов в значительной степени является причиной прогнозируемой сигнатуры транскрипции. Уменьшение нейтрофилов предотвращало смерть хозяина от самоусиливающегося повреждающего воспаления [66]. Galani et al. [27] обнаружили, что IFN типа I являются основными индукторами нейтрофильной инфильтрации, а нейтрофилы являются основными клетками, продуцирующими провоспалительные медиаторы в ответ на инфекцию IAV [27]. IFN типа I участвуют в управляемом нейтрофилами провоспалительном каскаде в легких, который индуцируется после инфекции IAV.Параллельно IFN типа I действуют синергетически с IFN-γ, подавляя инфильтрацию нейтрофилов и подавляя продукцию хемотаксических хемокинов / цитокинов нейтрофилами при инфекции IAV [67]. В таких случаях передача сигналов IFN типа I необходима, но недостаточна для предотвращения рекрутирования нейтрофилов в легкие мышей, инфицированных IAV. IFN типа I способствуют усилению регуляции хемокинов MCP-1, MCP-3 и IP-10 с усилением воспалительного / хемотаксического сигнала и дальнейшим привлечением моноцитов / макрофагов и Т-лимфоцитов к месту инфекции [68].Новое исследование раскрывает новый IFN-зависимый регуляторный механизм, предназначенный для предотвращения чрезмерной иммунопатологии при сохранении его противовирусных функций. У мышей IFNAR1 — / — развиваются значительные дефекты инфильтрации моноцитов Ly6C hi в легкие после инфекции IAV. Моноциты Ly6C hi мышей WT являются основными продуцентами MCP-1, в то время как альтернативно генерируемые моноциты Ly6C int IFNAR — / — мышей в основном продуцируют цитокины для притока нейтрофилов. Как следствие, мыши IFNAR1 — / — рекрутируют больше нейтрофилов после заражения гриппом, чем мыши WT [17].Защитная функция IFNs типа I связана не только с рекрутированием классических воспалительных моноцитов Ly6C hi в IAV-инфицированные легкие, но также с предотвращением чрезмерной активации моноцитов IFN-γ [67]. Таким образом, оказывается, что IFN типа I диктует гомеостаз гемопоэтических стволовых клеток, контролируя приток нейтрофилов и активацию моноцитов в месте воспаления.

NK-клетки представляют собой большие гранулярные врожденные лимфоидные клетки, которые действуют как иммунные регуляторы посредством продукции цитокинов и как цитотоксические эффекторные клетки.Их основные функции во время вирусной инфекции — производство IFN-γ и сдерживание репликации вируса путем уничтожения инфицированных клеток сразу после заражения гриппом [69]. Было показано, что IFN типа I играет заметную роль в опосредованном IAV размножении и активации NK-клеток [70, 71]. IFNs типа I оказывают прямое действие на NK-клетки, усиливая эффективные ответы NK-клеток в контексте инфекции гриппа и способствуя активации сигнальных путей NK-клеток, ответственных за цитотоксическую активность и продукцию цитокинов [72].Arimori et al. [73] показали, что мыши IFNAR — / — проявляют нарушенную цитотоксическую активность, а также повышенную способность NK- и CD8 + T-клеток продуцировать IFN-γ после заражения IAV. Следовательно, передача сигналов IFN типа I играет роль не только в усилении цитотоксичности, но также в подавлении некоторых эффекторных механизмов, включая продукцию IFN-γ NK и CD8 + Т-клетками посредством продукции IL-10 [73].

IFN типа I важны для стимуляции активации и выживания вирус-специфических Т-клеток и установления иммунной памяти [74–76].IFN типа I обладают мощным костимулирующим действием на CD8 + T-клетки, усиливая пролиферацию CD8 + T-клеток при внутренней передаче сигналов IFNAR1 Т-клеткам [77]. IFN типа I играет главную роль в ответе CD8 + Т-клеток на вирусную инфекцию, и его эффекты действуют как на APC, так и на Т-клетки. Фенотип Т-клеток и время воздействия IFN имеют важное значение, поскольку IFN может ингибировать пролиферацию или индуцировать апоптоз при некоторых обстоятельствах, но в других условиях оказывать сильное стимулирующее действие. В зависимости от статуса активации Т-клетки могут изменять уровни экспрессии IFNAR и экспрессию сигнальных молекул ниже IFNAR.Во-первых, IFN активирует MHC и костимулирующие молекулы. Во-вторых, IFN способствует апоптозу предсуществующих Т-клеток памяти, которые быстро фагоцитируются CD8α + DC. В-третьих, IFN непосредственно способствует пролиферации антиген (Ag) -специфических CD8 + Т-клеток в начале ответа. В-четвертых, IFN косвенно позволяет поздно прибывшим Ag-специфическим Т-клеткам становиться непосредственными эффекторами, но напрямую ингибирует пролиферацию этих клеток [77].

Клинические наблюдения и модели болезней человека на грызунах показали, что врожденные лимфоидные клетки группы 2 (клетки ILC2) играют важную роль в аллергических воспалительных реакциях, таких как астма и воспаление легких, вызванное патогенами.Duerr et al. [78] наблюдали увеличение количества клеток ILC2 и более дерегулированный врожденный и адаптивный иммунитет типа 2 у мышей с дефицитом IFNAR, инфицированных IAV, чем у инфицированных мышей WT, что продемонстрировало, что IFN типа I являются центральными регуляторами ILC2-опосредованных неблагоприятных иммунных ответов, которые могут приводить к патология тканей [78].

Определенные эффекты IFN-β

Инфекция IAV в основном индуцирует смесь различных подтипов IFN-α и IFN-β. В течение многих лет IFN типа I назывались IFN-α / β. Однако многие исследования показали, что отдельные подтипы IFN типа I могут иметь разные эффекты, несмотря на передачу сигналов через один и тот же рецептор, что приводит к разной противовирусной функции и биологическому эффекту.

Во время исследования активности усиления подтипа IFN типа I в дифференцировке DC, анализ транскриптомов показал, что уровень экспрессии 7 хемокинов и нескольких поверхностных маркеров DC различают подтипы IFN DC, IFNα-DC и IFNβ-DC [79]. Различия в противовирусной активности были также обнаружены среди всех подтипов IFN типа I, что измерялось по ингибированию репликации легочного вируса [80].

Несколько групп продемонстрировали, что существует иерархия временной экспрессии в семействе генов IFN типа I [81, 82].IFN-β является ранним ответчиком и играет важную роль в эффективной индукции всех IFN типа I после инфицирования первичных эмбриональных, а также первичных взрослых фибробластов вирусом Сендай. Исследования первичных фибробластов мышей с целевой делецией гена IFN-β в значительной степени подтвердили мнение о том, что IFN-β служит немедленным ранним IFN [83]. Продукция IFN-β не требует передачи сигналов через IFNAR [84, 85]. Кроме того, связывание IFN-β с IFNAR вызывает последующие транскрипционные ответы, приводящие к экспрессии IFN-α.IFN-β — / — мыши очень восприимчивы к инфекции вируса коровьей оспы, отчасти из-за неспособности вызвать соответствующий IFN-α ответ [86]. Во время гриппа клетки респираторного эпителия являются важными источниками IFN-β на ранней стадии, в то время как pDC действуют позже, впоследствии высвобождая высокие количества IFN-α и IFN-β [87].

Что касается регуляции экспрессии генов, оба промотора генов IFN-α и IFN-β имеют сайты связывания фактора регуляции интерферона (IRF), которые позволяют семейству факторов транскрипции IRF управлять продуцированием IFN.Однако промотор IFN-β имеет другие ответные элементы, включая сайты для NF-κB и AP-1 [88]. IFN-β может продуцироваться в более разнообразных обстоятельствах по сравнению с теми, которые приводят к продуцированию подтипов IFN-α. Это менее ограниченное производство IFN-β подразумевает функцию IFN-β, которая отличается от других IFN типа I.

Молекулярная основа гомеостаза. Роль IFN типа I

Как могут IFN типа I играть такую ​​сложную роль в генерации множества сигналов? Механизмы могут быть обусловлены вариациями в структурах 19 IFN типа I, а также различиями в их рецепторах.В частности, распределение рецепторов и сродство связывания между IFN и рецептором также могут играть роль в дифференциальных ответах передачи сигналов IFN.

IFN типа I распознаются и передаются через гетеродимерный IFNAR, состоящий из IFNAR1 и IFNAR2. Большинство исследований роли передачи сигналов IFN типа I в регуляции чувствительности хозяина к IAV были сосредоточены только на дефиците IFNAR1 (с использованием IFNAR1 — / — мышей). Однако отдельные субъединицы рецептора могут связывать IFN-β или IFN-α независимо друг от друга и индуцировать различную передачу сигналов.IFN-β и IFN-α, как известно, обладают разным сродством к IFNAR1 и IFNAR2 и вызывают разные профили экспрессии генов в зависимости от их концентрации и времени [50]. IFN-β имеет сродство к IFNAR1 или IFNAR2 в 20–30 раз по сравнению с IFN-α2 [89]. Свойства высокого сродства IFN-β могут объяснить 40-60-кратное увеличение активности пролиферации клеток этого подтипа IFN по сравнению с IFN-α2. Дополнительный эффект этого высокого сродства к рецепторам по сравнению с другими подвидами IFN типа I может объяснить, почему только IFN-β индуцирует отрицательные иммунорегулирующие факторы IL-10 и лиганд запрограммированной смерти 1 (PDL1) [90, 91], которые подавляют T- клеточные реакции, способствующие очищению от вирусов.

Новаторская работа Thomas et al. [92] показали, что различная аффинность IFN, способная вызывать различные функциональные эффекты, по-видимому, обусловлена ​​различением лигандов посредством различных рецептор-связывающих химикатов, которые определяют соответствующую стабильность взаимодействий рецептор-лиганд [92]. Повышенная аффинность связывания с IFNAR1 или IFNAR2 сильно усиливает подавление рецепторов. Подавленные эффекты врожденного иммунитета IFN типа I требовали более высокого сродства связывания с IFNAR.Позже де Верд и др. [88] установили, что IFN-β уникально и специфично лигируется с IFNAR1 IFNAR2-независимым образом. Комплекс IFNAR1-IFN-β трансдуцировал сигналы, которые модулировали экспрессию отдельного набора генов независимо от путей Jak-STAT. Передача сигналов IFNAR1-IFN-β является патологически значимой, поскольку липополисахарид-индуцированный сепсис уменьшался у мышей IFNAR1 — / -, но не у мышей IFNAR2 — / — [88].

Левин и др. [93, 94] показали, что варианты или мутанты IFN типа I индуцируют 2 различных паттерна экспрессии генов, основанные на аффинности рецептора IFN, количестве рецепторов и концентрации IFN [93, 94].Они назвали гены, экспрессируемые в первом паттерне, «устойчивыми» генами, многие из которых связаны с противовирусной активностью, тогда как гены, экспрессируемые в паттерне, чьи продукты обладают иммуномодулирующими и антипролиферативными функциями, называются «настраиваемыми» генами. Все IFNα связывают субъединицу рецептора IFNAR1 с низким сродством. Повышение аффинности связывания усиливало антипролиферативную активность IFNα2 [95].

Jaks et al. [96] обнаружили, что образование ISGF3 и противовирусная активность очень хорошо коррелируют со сродством связывания IFN с IFNAR2.Напротив, сродство к IFNAR1 играет ключевую роль в антипролиферативной активности [96]. Недавно Shepardson et al. [97] продемонстрировали, что, несмотря на некоторую избыточность, IFNAR1 и IFNAR2 играют разные роли в регуляции иммунитета против IAV. В отличие от мышей IFNAR1 — / -, мыши IFNAR2 — / -, инфицированные IAV, демонстрировали как повышенную, так и повышенную заболеваемость и смертность по сравнению с мышами WT [97]. Обработка мышей, у которых есть функциональный IFNAR2, но не IFNAR1 (IFNAR1 — / — мыши), IFN-β защищала этих мышей от заболеваемости и увеличивала их выживаемость по сравнению с IAV-инфицированными однопометниками дикого типа.Однако обработка IFNαA мышей, дефицитных по любой из субъединиц IFNAR, не оказывала влияния на индуцированную IAV потерю массы тела по сравнению с их необработанными однопометниками. Таким образом, в отличие от IFNAR1, IFNAR2 был достаточным для создания защиты от летальной инфекции IAV при стимуляции IFN-β.

Вместе аффинности и время пребывания связывания рецептора, уровень экспрессии поверхностного рецептора и типы клеток, в которых расположены рецепторы, могут определять различные ответы среди всех подтипов IFN типа I [98].Доступны многоуровневые механизмы обратной связи для предотвращения пагубных последствий для рецептора IFN и активации последующих сигналов.

Резюме

Инфекция IAV является основной причиной инфекционной заболеваемости и смертности во всем мире [99]. Недавние исследования на мышах выявили ключевую роль IFN типа I в защите хозяина от IAV. Они быстро активируют нижестоящие сигнальные сети ISG и ограничивают вирусную репликацию. IFN типа I способствуют активации клеток врожденного иммунитета, индуцируют адаптивный иммунитет и регулируют врожденные и адаптивные ответы.Многие открытия, касающиеся эффектов IFN на моделях мышей, привели к открытию параллельных явлений у людей. Хотя они не могут полностью воспроизвести человеческое заболевание, мышиные модели позволили исследователям использовать генетические стратегии для расшифровки механизмов, которые имеют решающее значение для ответа IFN на IAV in vivo. Однако в наших знаниях о роли интерферонов типа I в инфицировании человека гриппом существуют значительные пробелы. По-прежнему необходимы дальнейшие исследования для выяснения роли IFN типа I в ответе хозяина на IAV у людей.

IFN типа I должны строго регулироваться, чтобы максимизировать вирусный клиренс при минимальном повреждении клеток-хозяев. Это особенно сложно при борьбе с инфекцией гриппа, поскольку смертность от ВГА тесно связана с вторичными бактериальными инфекциями. Вирусный клиренс должен осуществляться при быстром разрешении воспаления, вызванного первичной вирусной инфекцией, иначе произойдет инвазия патогенов и вторичная бактериальная пневмония [100]. Понимание эффектов IFN типа I даст важные практические результаты, включая возможное использование иммуносупрессивных или противовоспалительных мер в терапии гриппа.

Использование модификаторов биологической реакции при болезнях человека достигло совершеннолетия при многих заболеваниях, включая рак, аутоиммунные заболевания и некоторые вирусные инфекции. Для того чтобы ИФН типа I или другие ИФН можно было использовать в терапевтических целях при гриппозной инфекции, мы должны понимать их механизмы, чтобы их можно было использовать в качестве противовирусных супергероев, быстро излечивающих вирусную инфекцию, и не становясь иммунопатогенными злодеями, усугубляющими действие вирусов. повреждение тканей.

Благодарности

Авторы выражают благодарность Др.Джиллиан М. Эйр (OUHSC, Оклахома-Сити, Оклахома, США) за критическое чтение рукописи и полезные комментарии.

Заявление о раскрытии информации

Авторы заявляют об отсутствии конфликта интересов.

Источники финансирования

Работа была частично поддержана пилотными грантами Oklahoma Shared Clinical and Translational Resource (OSCTR) (номер гранта U54GM104938 для WW), Программой оценки заслуг Министерства по делам ветеранов (грант номер I01 BX001937 для JPM), и Национальный институт общих медицинских наук (грант номер 5P20GM103648, J.ВЕЧЕРА).

Вклад авторов

Оба W.W. и J.P.M. были вовлечены в написание рукописей.

Список литературы

  1. Manicassamy B, Manicassamy S, Belicha-Villanueva A, Pisanelli G, Pulendran B, García-Sastre A.Анализ динамики заражения вирусом гриппа у мышей in vivo с использованием репортерного вируса GFP. Proc Natl Acad Sci U S. A. 2010; 107 (25): 11531–6.
  2. Кочча Е.М., Севера М., Джакомини Э., Моннерон Д., Ремоли М.Э., Юлкунен И. и др. Вирусная инфекция и агонисты Toll-подобных рецепторов индуцируют дифференциальную экспрессию интерферонов типа I и лямбда в плазматических плазматических и моноцитарных дендритных клетках человека.Eur J Immunol. 2004. 34 (3): 796–805.
  3. Ди Франко С., Турдо А., Тодаро М., Стасси Г. Роль интерферонов типа I и II в колоректальном раке и меланоме. Фронт Иммунол. 2017; 8: 878.
  4. Холл JC, Розен А.Интерфероны I типа: важнейшие участники усиления аутоиммунного заболевания. Nat Rev Rheumatol. 2010. 6 (1): 40–9.
  5. Secombes CJ, Zou J. Эволюция интерферонов и рецепторов интерферона. Фронт Иммунол. 2017; 8: 209.
  6. Линденманн Дж., Берк Д.К., Айзекс А.Исследования по производству, механизму действия и свойствам интерферона. Br J Exp Pathol. 1957. 38 (5): 551–62.
  7. Свецки М., Колонна М. Интерфероны типа I: разнообразие источников, пути производства и влияние на иммунные ответы. Curr Opin Virol. 2011; 1 (6): 463–75.
  8. Пестка S, Krause CD, Вальтер MR.Интерфероны, интерфероноподобные цитокины и их рецепторы. Immunol Rev.2004; 202; 8–32.
  9. Кляйн-младший, Раулет Д.Х., Пастернак М.С., Беван М.Дж. Цитотоксические Т-лимфоциты продуцируют иммунный интерферон в ответ на антиген или митоген. J Exp Med. 1982; 155 (4): 1198–203.
  10. Scharton TM, Скотт П.Естественные клетки-киллеры являются источником гамма-интерферона, который стимулирует дифференцировку субпопуляций CD4 + Т-клеток и вызывает у мышей раннюю устойчивость к Leishmania major. J Exp Med. 1993. 178 (2): 567–77.
  11. Sommereyns C, Paul S, Staeheli P, Michiels T. IFN-лямбда (IFN-λ) экспрессируется тканезависимым образом и в первую очередь действует на эпителиальные клетки in vivo.PLoS Pathog. 2008; 4 (3): e1000017.
  12. Котенко С.В., Галлахер Г., Баурин В.В., Льюис-Антес А., Шен М., Шах Н.К. и др. IFN-лямбды опосредуют противовирусную защиту через особый рецепторный комплекс цитокинов класса II. Nat Immunol. 2003. 4 (1): 69–77.
  13. Миллер JL, Андерс EM.Взаимодействие вирус-клетка при индукции интерферона 1 типа вирусом гриппа в клетках селезенки мышей. J Gen Virol. 2003. 84 (Pt 1): 193–202.
  14. Ли С.Ф., Гонг М.Дж., Чжао Ф.Р., Шао Дж.Дж., Се Ю.Л., Чжан Ю.Г. и др. Интерфероны типа I: различные виды биологической активности и современные применения при вирусной инфекции.Cell Physiol Biochem. 2018; 51 (5): 2377–96.
  15. Platanias LC. Механизмы передачи сигналов, опосредованной интерфероном типа I и типа II. Nat Rev Immunol. 2005. 5 (5): 375–86.
  16. Чжоу А., Паранджапе Дж. М., Дер С. Д., Уильямс Б. Р., Сильверман Р. Х.Действие интерферона у мышей с тройным дефицитом показывает существование альтернативных противовирусных путей. Вирусология. 1999. 258 (2): 435–40.
  17. Сео СУ, Квон Х.Дж., Ко Х.Дж., Бьюн Й.Х., Сеонг Б.Л., Уэмацу С. и др. Передача сигналов интерферона типа I регулирует моноциты и нейтрофилы Ly6C (hi) во время острой вирусной пневмонии у мышей.PLoS Pathog. 2011; 7 (2): e1001304.
  18. Koerner I, Kochs G, Kalinke U, Weiss S, Staeheli P. Защитная роль бета-интерферона в защите хозяина от вируса гриппа А. J Virol. 2007. 81 (4): 2025–2030.
  19. Дэвидсон С., Майни М.К., Вак А.Стимулирующие заболевание эффекты интерферонов типа I при вирусных, бактериальных и коинфекциях. J Interferon Cytokine Res. 2015; 35 (4): 252–64.
  20. Беннетт А.Л., Смит Д.В., Камминс М.Дж., Якоби П.А., Камминз Дж.М., Бейльхарц М.В. Низкие дозы перорального интерферона альфа в качестве профилактики вирусных респираторных заболеваний: двойное слепое параллельное контролируемое исследование в год пандемии гриппа.Другие вирусы гриппа респира. 2013. 7 (5): 854–62.
  21. Steel J, Staeheli P, Mubareka S, García-Sastre A, Palese P, Lowen AC. Передача пандемического вируса гриппа h2N1 и влияние предшествующего контакта с сезонными штаммами или лечением интерфероном. J Virol. 2010. 84 (1): 21–6.
  22. Кугель Д., Кохс Г., Обойес К., Рот Дж., Кобингер Г.П., Кобаса Д. и др.Интраназальное введение альфа-интерферона снижает заболеваемость хорьками вирусом сезонного гриппа А. J Virol. 2009. 83 (8): 3843–51.
  23. Гарсия-Састре А., Дурбин Р.К., Чжэн Х., Палезе П., Гертнер Р., Леви Д.Е. и др. Роль интерферона в тканевом тропизме вируса гриппа. J Virol.1998. 72 (11): 8550–8.
  24. Прайс Г.Е., Гашевска-Мастарларц А., Москофидис Д. Роль альфа / бета- и гамма-интерферонов в развитии иммунитета к вирусу гриппа А у мышей. J Virol. 2000. 74 (9): 3996–4003.
  25. Crotta S, Davidson S, Mahlakoiv T, Desmet CJ, Buckwalter MR, Albert ML, et al.Интерфероны типа I и типа III управляют избыточными петлями амплификации для индукции транскрипционной сигнатуры в инфицированном гриппом эпителии дыхательных путей. PLoS Pathog. 2013; 9 (11): e1003773.
  26. Zanoni I, Granucci F, Broggi A. Интерферон (IFN) -λ берет на себя управление: иммуномодулирующая роль IFN типа III.Фронт Иммунол. 2017; 8: 1661.
  27. Galani IE, Triantafyllia V, Eleminiadou EE, Koltsida O, Stavropoulos A, Manioudaki M, et al. Интерферон-λ обеспечивает неизбыточную передовую противовирусную защиту от заражения вирусом гриппа без ущерба для приспособленности хозяина. Иммунитет. 2017; 46 (5): 875–890.e6.
  28. Klinkhammer J, Schnepf D, Ye L, Schwaderlapp M, Gad HH, Hartmann R, et al. IFN-λ предотвращает распространение вируса гриппа из верхних дыхательных путей в легкие и ограничивает передачу вируса. Элиф. 2018; 7: e33354.
  29. Wilson EB, Yamada DH, Elsaesser H, Herskovitz J, Deng J, Cheng G и др.Блокада хронической передачи сигналов интерферона типа I для контроля стойкой инфекции LCMV. Наука. 2013. 340 (6129): 202–7.
  30. Тейджаро Дж. Р., Нг Си, Ли А.М., Салливан Б.М., Шихан К.С., Уэлч М. и др. Стойкая инфекция LCMV контролируется блокадой передачи сигналов интерферона I типа. Наука.2013; 340 (6129): 207–11.
  31. La Gruta NL, Kedzierska K, Stambas J, Doherty PC. Вопрос самосохранения: иммунопатология при вирусной инфекции гриппа. Immunol Cell Biol. 2007. 85 (2): 85–92.
  32. Tumpey TM, García-Sastre A, Taubenberger JK, Palese P, Swayne DE, Pantin-Jackwood MJ, et al.Патогенность вирусов гриппа с генами пандемического вируса 1918 года: функциональные роли альвеолярных макрофагов и нейтрофилов в ограничении репликации вируса и смертности у мышей. J Virol. 2005. 79 (23): 14933–44.
  33. Cillóniz C, Shinya K, Peng X, Korth MJ, Proll SC, Aicher LD и др.Смертельная инфекция вируса гриппа у макак связана с ранним нарушением регуляции генов, связанных с воспалением. PLoS Pathog. 2009; 5 (10): e1000604.
  34. Кобаса Д., Джонс С.М., Шинья К., Каш Дж.С., Коппс Дж., Эбихара Х. и др. Аберрантный врожденный иммунный ответ при летальном заражении макак вирусом гриппа 1918 г.Природа. 2007. 445 (7125): 319–23.
  35. Cheung CY, Poon LL, Lau AS, Luk W., Lau YL, Shortridge KF и др. Индукция провоспалительных цитокинов в макрофагах человека вирусами гриппа A (H5N1): механизм необычной тяжести заболевания человека? Ланцет. 2002; 360 (9348): 1831–7.
  36. Хайден Ф.Г., Фриц Р., Лобо М.С., Элворд В., Стробер В., Штраус С.Е. Местные и системные цитокиновые ответы при экспериментальной инфекции вируса гриппа человека А. Связь с формированием симптомов и защитой хозяина. J Clin Invest. 1998. 101 (3): 643–9.
  37. Кайзер Л., Фриц Р.С., Штраус С.Е., Губарева Л., Хайден Ф.Г.Патогенез симптомов при остром гриппе: ответы на интерлейкин-6 и другие цитокины. J Med Virol. 2001. 64 (3): 262–8.
  38. Герольд С., Беккер С., Ридж К.М., Бюдингер Г.Р. Повреждение легких, вызванное вирусом гриппа: патогенез и значение для лечения. Eur Respir J. 2015; 45 (5): 1463–78.
  39. Хёгнер К., Вольф Т., Плешка С., Плог С., Грубер А.Д., Калинке У. и др. Экспрессируемый макрофагами IFN-β способствует апоптотическому повреждению альвеолярных эпителиальных клеток при тяжелой пневмонии, вызванной вирусом гриппа. PLoS Pathog. 2013; 9 (2): e1003188.
  40. Герольд С., Штайнмюллер М., фон Вульфен В., Чакарова Л., Пинто Р., Плешка С. и др.Апоптоз эпителия легких при пневмонии, вызванной вирусом гриппа: роль лиганда, индуцирующего апоптоз, экспрессируемого макрофагами. J Exp Med. 2008. 205 (13): 3065–77.
  41. Шаперот Л., Блюм А., Манчес О, Луи Дж., Анхель Дж., Моленс Дж. П. и др. Агонисты вирусов или TLR индуцируют TRAIL-опосредованную цитотоксическую активность плазматических дендритных клеток.J Immunol. 2006. 176 (1): 248–55.
  42. Дэвидсон С., Кротта С., МакКейб TM, Вак А. Патогенный потенциал интерферона αβ при острой инфекции гриппа. Nat Commun. 2014; 5: 3864.
  43. Фудзикура Д., Чиба С., Мурамацу Д., Казумата М., Накаяма Ю., Кавай Т. и др.Интерферон типа I имеет решающее значение для экспрессии FasL на клетках легких и определяет тяжесть гриппа. PLoS One. 2013; 8 (2): e55321.
  44. Искандер М., Буй Р., Ламберт С. Бремя гриппа у детей. Curr Opin Infect Dis. 2007. 20 (3): 259–63.
  45. Cowling BJ, Chan KH, Fang VJ, Lau LLH, So HC, Fung ROP и др.Сравнительная эпидемиология пандемии и сезонного гриппа А в домашних хозяйствах. N Engl J Med. 2010. 362 (23): 2175–84.
  46. Цинкернагель РМ. Иммунологическая память ≠ защитный иммунитет. Cell Mol Life Sci. 2012. 69 (10): 1635–40.
  47. Лоеб М., Сингх П.К., Фокс Дж., Рассел М.Л., Паббараджу К., Зарра Д. и др.Продольное исследование распространения молекулярных вирусов гриппа в сообществах гуттеритов. J Infect Dis. 2012. 206 (7): 1078–84.
  48. Коутс Б.М., Старича К.Л., Кох С.М., Ченг Й., Шумакер Д.К., Budinger GRS и др. Воспалительные моноциты вызывают повреждение легких, опосредованное вирусом гриппа А, у молодых мышей.J Immunol. 2018; 200 (7): 2391–404.
  49. Oshansky CM, Gartland AJ, Wong SS, Jeevan T., Wang D, Roddam PL и др. Иммунные ответы слизистых оболочек позволяют прогнозировать клинические исходы во время гриппа независимо от возраста и вирусной нагрузки. Am J Respir Crit Care Med. 2014. 189 (4): 449–62.
  50. Порритт Р.А., Герцог П.Дж.Динамическое управление сигнализацией IFN типа I с помощью интегрированной сети отрицательных регуляторов. Trends Immunol. 2015; 36 (3): 150–60.
  51. Ли А.Дж., Ашкар А.А. Двойственная природа интерферонов I и II типа. Фронт Иммунол. 2018; 9: 2061.
  52. Мур Б.Р., Краковка С., Камминз Дж. М., Робертсон Дж. Т..Изменения в популяции воспалительных клеток дыхательных путей у стандартных породистых скаковых лошадей после введения интерферона-альфа. Vet Immunol Immunopathol. 1996. 49 (4): 347–58.
  53. Гибб Д. Р., Лю Дж., Натараджан П., Сантханакришнан М., Мадрид Д. Д., Эйзенбарт С. К. и др. IFN типа I необходим и достаточен для вызванной воспалением аллоиммунизации эритроцитов у мышей.J Immunol. 2017; 199 (3): 1041–50.
  54. Кудо Д., Уно К., Аояги Т., Акахори Ю., Исии К., Канно Е. и др. Лечение низкими дозами интерферона-α улучшает выживаемость и воспалительные реакции на мышиной модели молниеносного острого респираторного дистресс-синдрома. Воспаление. 2013; 36 (4): 812–20.
  55. Gold JA, Hoshino Y, Jones MB, Hoshino S, Nolan A, Weiden MD. Экзогенный интерферон-альфа и интерферон-гамма повышают летальность мышиной сибирской язвы при вдыхании. PLoS One. 2007; 2 (8): e736.
  56. Курче Дж. С., Халущак К., МакВильямс Дж. А., Санчес П. Дж., Кедл Р. М..IFN-зависимая активация Т-клеток типа I опосредуется IFN-зависимой экспрессией лиганда OX40 дендритных клеток и не зависит от экспрессии IFNR Т-клеток. J Immunol. 2012. 188 (2): 585–93.
  57. Сантини С.М., Лапента С., Логоцци М., Парлато С., Спада М., Ди Пуккио Т. и др. Интерферон типа I как мощный адъювант для развития и активности моноцитарных дендритных клеток in vitro и у мышей Hu-PBL-SCID.J Exp Med. 2000. 191 (10): 1777–88.
  58. Монтойя М., Скьявони Дж., Маттей Ф., Грессер И., Беларделли Ф., Заимствование П. и др. Интерфероны типа I, продуцируемые дендритными клетками, способствуют их фенотипической и функциональной активации. Кровь. 2002. 99 (9): 3263–71.
  59. Симмонс Д.П., Вирш П.А., Канадей Д.Х., Мейерсон Х.Дж., Лю Ю.К., Ван И и др.IFN типа I управляет характерным фенотипом созревания дендритных клеток, который позволяет продолжать синтез MHC класса II и процессинг антигена. J Immunol. 2012. 188 (7): 3116–26.
  60. Даунс Дж. Э., Маршалл-Кларк С. Врожденные иммунные стимулы модулируют продукцию дендритных клеток костного мозга in vitro с помощью зависимых от толл-подобных рецепторов и независимых механизмов.Иммунология. 2010. 131 (4): 513–24.
  61. Радд Б.Д., Люкер Г.Д., Люкер К.Э., Пиблз Р.С., Лукач С.З. Интерферон I типа регулирует созревание дендритных клеток, инфицированных респираторным вирусом, и выработку цитокинов. Viral Immunol. 2007. 20 (4): 531–40.
  62. Мольтедо Б., Ли В., Юнт Дж. С., Моран TM.Уникальные ответы интерферона типа I определяют функциональную судьбу мигрирующих дендритных клеток легких во время инфицирования вирусом гриппа. PLoS Pathog. 2011; 7 (11): e1002345.
  63. Хелфт Дж., Маникассами Б., Гермонпрез П., Хашимото Д., Сильвин А., Агудо Дж. И др. Кросс-презентирующие дендритные клетки CD103 + защищены от заражения вирусом гриппа.J Clin Invest. 2012. 122 (11): 4037–47.
  64. Langlois RA, Varble A, Chua MA, García-Sastre A, tenOever BR. Гемопоэтическое нацеливание вируса гриппа A выявляет потребности в репликации для индукции противовирусных иммунных ответов. Proc Natl Acad Sci U S. A. 2012; 109 (30): 12117–22.
  65. Hemann EA, Green R, Turnbull JB, Langlois RA, Savan R, Gale M Jr. Интерферон-λ модулирует дендритные клетки для облегчения Т-клеточного иммунитета во время заражения вирусом гриппа А. Nat Immunol. 2019; 20 (8): 1035–45.
  66. Брандес М., Клаушен Ф., Кучен С., Жермен Р.Н.Системный анализ выявляет воспалительный контур с прямой связью, ведущий к летальной инфекции гриппа. Клетка. 2013. 154 (1): 197–212.
  67. Стифтер С.А., Бхаттачарья Н., Пиллэй Р., Флоридо М., Трикас Дж. А., Бриттон В. Дж. И др. Функциональное взаимодействие между интерферонами типа I и II необходимо для ограничения воспаления тканей, вызванного вирусом гриппа А.PLoS Pathog. 2016; 12 (1): e1005378.
  68. Юлкунен И., Мелен К., Нюквист М., Пирхонен Дж., Саренева Т., Матикайнен С. Воспалительные реакции при инфекции вируса гриппа А. Вакцина. 2000; 19 (Приложение 1): S32–7.
  69. Шульц-Черри С.Роль NK-клеток в гриппозной инфекции. Curr Top Microbiol Immunol. 2015; 386: 109–20.
  70. Бирон CA, Нгуен КБ, Пьен GC, Cousens LP, Salazar-Mather TP. Естественные клетки-киллеры в противовирусной защите: функция и регуляция врожденными цитокинами. Анну Рев Иммунол. 1999; 17: 189–220.
  71. Нгуен КБ, Салазар-Матер Т.П., Далод М.Ю., Ван Деусен Дж.Б., Вей XQ, Лью Ф.Й. и др. Скоординированные и различные роли IFN-альфа-бета, IL-12 и IL-15 в регуляции ответов NK-клеток на вирусную инфекцию. J Immunol. 2002. 169 (8): 4279–87.
  72. Hwang I, Scott JM, Kakarla T., Duriancik DM, Choi S, Cho C и др.Механизмы активации естественных клеток-киллеров при заражении вирусом гриппа. PLoS One. 2012; 7 (12): e51858.
  73. Аримори Й., Накамура Р., Ямада Х., Шибата К., Маеда Н., Касе Т. и др. Интерферон типа I играет противоположную роль в цитотоксичности и продукции интерферона-γ естественными киллерами и Т-клетками CD8 после инфицирования мышей вирусом гриппа А.J. Врожденный иммунитет. 2014. 6 (4): 456–66.
  74. Хавенар-Доутон С., Колумам Г.А., Мурали-Кришна К. Передовая кромка: прямое действие интерферона типа I на Т-клетки CD4 имеет решающее значение для поддержания клональной экспансии в ответ на вирусную, но не бактериальную инфекцию. J Immunol. 2006. 176 (6): 3315–9.
  75. Колумам Г.А., Томас С., Томпсон Л.Дж., Спрент Дж., Мурали-Кришна К. Интерфероны типа I действуют непосредственно на Т-клетки CD8, обеспечивая клональную экспансию и формирование памяти в ответ на вирусную инфекцию. J Exp Med. 2005. 202 (5): 637–50.
  76. Томпсон Л.Дж., Колумам Г.А., Томас С., Мурали-Кришна К.Врожденные воспалительные сигналы, индуцируемые различными патогенами, по-разному определяют зависимость Т-лимфоцитов CD8 от IFN-I в отношении клональной экспансии и формирования памяти. J Immunol. 2006. 177 (3): 1746–54.
  77. Валлийский RM, Bahl K, Marshall HD, Urban SL. Интерфероны 1 типа и противовирусные Т-клеточные ответы CD8.PLoS Pathog. 2012; 8 (1): e1002352.
  78. Duerr CU, McCarthy CD, Mindt BC, Rubio M, Meli AP, Pothlichet J, et al. Интерферон I типа ограничивает иммунопатологию 2-го типа за счет регуляции врожденных лимфоидных клеток 2-й группы. Nat Immunol. 2016; 17 (1): 65–75.
  79. Гарсин Дж., Бордат Й., Чучана П., Моннерон Д., Ло Х. К., Пилер Дж. И др.Дифференциальная активность подтипов интерферона I типа для дифференцировки дендритных клеток. PLoS One. 2013; 8 (3): e58465.
  80. Джеймс СМ, Абдад М.Ю., Мэнсфилд Дж. П., Якобсен Х. К., Винд А. Р., Stumbles PA и др. Дифференциальная активность подтипов альфа / бета IFN против вируса гриппа in vivo и усиление специфических иммунных ответов у мышей, вакцинированных ДНК, экспрессирующих гемагглютинин и нуклеопротеин.Вакцина. 2007. 25 (10): 1856–67.
  81. Марие I, Дурбин JE, Леви DE. Дифференциальная вирусная индукция отдельных генов интерферона-альфа по положительной обратной связи через фактор регуляции интерферона-7. EMBO J. 1998; 17 (22): 6660–9.
  82. Juang YT, Lowther W., Kellum M, Au WC, Lin R, Hiscott J, et al.Первичная активация транскрипции генов интерферона А и интерферона В фактором регуляции интерферона 3. Proc Natl Acad Sci U S. A. 1998; 95 (17): 9837–42.
  83. Samuelsson CV, Lienenklaus S, Müller PP, Zawatzky R, Hauser H, Weiss S. Трансформация фибробластов мыши изменяет модель индукции IFN типа I после вирусной инфекции.Biochem Biophys Res Commun. 2005. 335 (2): 584–9.
  84. Танигучи Т., Такаока А. Слабый сигнал для сильных ответов: пересмотр интерферона-альфа / бета. Nat Rev Mol Cell Biol. 2001. 2 (5): 378–86.
  85. Каваи Т., Акира С.Роль рецепторов распознавания образов в врожденном иммунитете: обновленная информация о Toll-подобных рецепторах. Nat Immunol. 2010. 11 (5): 373–84.
  86. Деонарайн Р., Альками А., Алексиу М., Даллман М.Дж., Геверт Д.Р., Портер А.С. Нарушение противовирусного ответа и индукции альфа / бета-интерферона у мышей, лишенных бета-интерферона.J Virol. 2000. 74 (7): 3404–9.
  87. Джуэлл Н.А., Вагефи Н., Мерц С.Е., Актер П., Пиблс Р.С. мл., Бакалетц Л.О. и др. Дифференциальная индукция интерферона I типа респираторно-синцитиальным вирусом и вирусом гриппа a in vivo. J Virol. 2007. 81 (18): 9790–800.
  88. де Верд Н.А., Вивиан Дж. П., Нгуен Т.К., Манган Н.Э., Гулд Дж.А., Бранифф С.Дж. и др.Структурная основа уникальной оси передачи сигналов интерферона-β, опосредованной рецептором IFNAR1. Nat Immunol. 2013. 14 (9): 901–7.
  89. Джайтин Д.А., Ройсман Л.С., Якс Э., Гавутис М., Пилер Дж., Ван дер Хейден Дж. И др. Изучение дифференциального действия интерферонов (IFN): мутант IFN-альфа2 с повышенным сродством к IFNAR1 функционально подобен IFN-бета.Mol Cell Biol. 2006; 26 (5): 1888–97.
  90. Сараива М., О’Гарра А. Регулирование выработки ИЛ-10 иммунными клетками. Nat Rev Immunol. 2010. 10 (3): 170–81.
  91. Шарп А.Х., Уэрри Э.Дж., Ахмед Р., Фриман Г.Дж.Функция запрограммированной гибели клеток 1 и ее лигандов в регулировании аутоиммунитета и инфекции. Nat Immunol. 2007. 8 (3): 239–45.
  92. Thomas C, Moraga I, Levin D, Krutzik PO, Podoplelova Y, Trejo A, et al. Структурная связь между дискриминацией лиганда и активацией рецептора интерферонами типа I.Клетка. 2011. 146 (4): 621–32.
  93. Левин Д., Харари Д., Шрайбер Г. Экспрессия стохастических рецепторов определяет судьбу клеток при лечении интерфероном. Mol Cell Biol. 2011. 31 (16): 3252–66.
  94. Левин Д., Шнайдер В. М., Хоффманн Х. Х., Ярден Г., Бузетто А. Г., Поместье О. и др.Многогранная активность интерферона I типа выявляется антагонистом рецепторов. Sci Signal. 2014; 7 (327): ра50.
  95. Kalie E, Jaitin DA, Abramovich R, Schreiber G. Мутант интерферона альфа2, оптимизированный с помощью фагового дисплея для связывания IFNAR1, обеспечивает специфически усиленную противоопухолевую активность.J Biol Chem. 2007. 282 (15): 11602–11.
  96. Jaks E, Gavutis M, Uzé G, Martal J, Piehler J. Дифференциальная аффинность рецепторных субъединиц интерферонов типа I регулирует активацию дифференциального сигнала. J Mol Biol. 2007. 366 (2): 525–39.
  97. Шепардсон К.М., Ларсон К., Джонс Л.Л., Станек К., Чо Х., Веллхэм Дж. И др.IFNAR2 необходим для противогриппозного иммунитета и изменяет восприимчивость к бактериальным суперинфекциям после гриппа. Фронт Иммунол. 2018; 9: 2589.
  98. Шрайбер Г. Молекулярные основы дифференциальной передачи сигналов интерферона I типа. J Biol Chem. 2017; 292 (18): 7285–94.
  99. Дэвис М.М., Тауберт К., Бенин А.Л., Браун Д.В., Менса Г.А., Баддур Л.М. и др.Вакцинация против гриппа как вторичная профилактика сердечно-сосудистых заболеваний: научный совет Американской кардиологической ассоциации / Американского колледжа кардиологии. J Am Coll Cardiol. 2006. 48 (7): 1498–502.
  100. Биондо С., Лентини Дж., Бенинати С., Тети Дж. Двойная роль врожденного иммунитета во время гриппа.Биомед Дж. 2019; 42 (1): 8–18.

Автор Контакты

Wenxin Wu

Департамент медицины

Научно-медицинский центр Университета Оклахомы

800 N. Research Pkwy, Room 425, Оклахома-Сити, OK 73104 (США)

[email protected]


Подробности статьи / публикации

Предварительный просмотр первой страницы

Поступила в редакцию: 29 января 2020 г.
Дата принятия: 3 мая 2020 г.
Опубликована онлайн: 19 июня 2020 г.
Дата выпуска: ноябрь — декабрь

г.

Количество страниц для печати: 11
Количество рисунков: 2
Количество столов: 0

ISSN: 1662-811X (печатный)
eISSN: 1662-8128 (онлайн)

Для дополнительной информации: https: // www.karger.com/JIN


Лицензия открытого доступа / Дозировка лекарства / Заявление об ограничении ответственности

Эта статья находится под международной лицензией Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 (CC BY-NC-ND). Использование и распространение в коммерческих целях, а также любое распространение измененных материалов требует письменного разрешения. Дозировка лекарств: авторы и издатель приложили все усилия, чтобы гарантировать, что выбор и дозировка лекарств, указанные в этом тексте, соответствуют текущим рекомендациям и практике на момент публикации.Однако ввиду продолжающихся исследований, изменений в правительственных постановлениях и постоянного потока информации, касающейся лекарственной терапии и реакций на них, читателю настоятельно рекомендуется проверять листок-вкладыш для каждого препарата на предмет любых изменений показаний и дозировки, а также дополнительных предупреждений. и меры предосторожности. Это особенно важно, когда рекомендованным агентом является новое и / или редко применяемое лекарство. Отказ от ответственности: утверждения, мнения и данные, содержащиеся в этой публикации, принадлежат исключительно отдельным авторам и соавторам, а не издателям и редакторам.Появление в публикации рекламы и / или ссылок на продукты не является гарантией, одобрением или одобрением рекламируемых продуктов или услуг или их эффективности, качества или безопасности. Издатель и редактор (-ы) не несут ответственности за любой ущерб, причиненный людям или имуществу в результате любых идей, методов, инструкций или продуктов, упомянутых в контенте или рекламе.

границ | Функциональное истощение продукции интерферонов типа I и II у пациентов с тяжелой формой COVID-19

Введение

В начале декабря 2019 г. первые случаи вирусной пневмонии неизвестного происхождения были выявлены в Ухане, столице провинции Хубэй в Китае (1, 2).Ответственный за вирус был идентифицирован как новый бета-коронавирус, который теперь называется коронавирусом 2 тяжелого острого респираторного синдрома (SARS-CoV-2) из ​​того же семейства, что и SARS-CoV, ответственный за вспышку SARS в 2003 году. Этот коронавирус, вызывающий новое коронавирусное заболевание. (COVID-19) с тех пор распространился по миру и вызвал пандемию (3, 4).

Общие симптомы у пациентов с COVID-19 включают лихорадку, сухой кашель, аносмию, одышку и другие гриппоподобные симптомы (3–5). Несмотря на то, что у большинства пациентов могут оставаться полностью бессимптомные симптомы или могут проявляться только легкие симптомы, у 10–20% пациентов развивается тяжелое заболевание, характеризующееся тяжелой пневмонией, острым респираторным дистресс-синдромом и полиорганной недостаточностью, требующей немедленной госпитализации в отделения интенсивной терапии и часто приводит к смерти (3, 6, 7).Тяжелые клинические симптомы, такие как диффузное поражение альвеол, тромбоз, гемофагоцитоз и истощение иммунных клеток, были описаны в подгруппе пациентов с тяжелой формой COVID-19 (8). Пациенты, страдающие диабетом, раком или другими хроническими заболеваниями, наиболее подвержены риску развития тяжелой формы (9).

Чтобы лучше разделить пациентов, которые могут подвергаться риску осложнений, многочисленные исследования выявили биологические маркеры с худшим прогнозом, такие как лимфопения, и воспалительные маркеры, такие как C-реактивный белок (CRP), лактатдегидрогеназа (LDH) и уровни цитокинов (3). , 10–15).

Несколько авторов исследовали роль различных цитокинов у пациентов с COVID-19. В рамках иммунологического ответа на инфекцию SARS-CoV-2 пациенты часто проявляют агрессивный и неконтролируемый воспалительный ответ с секрецией большого количества провоспалительных цитокинов, таких как интерлейкин (IL) 6, IL10 и фактор некроза опухоли α. (TNFα) в событии, известном как цитокиновый шторм (3, 16–22). Цитокиновый шторм напрямую коррелирует с повреждением легких, полиорганной недостаточностью и неблагоприятным прогнозом (19).

Взаимодействие между врожденным и адаптивным иммунным ответом, по-видимому, имеет решающее значение для определения эволюции пациента, характеризующейся дисбалансом про- и противовоспалительных цитокинов и последующим нарушением регуляции иммунного ответа пациента (23). Интерфероны (IFN) действуют как ключевое звено между врожденным и адаптивным иммунным ответом. IFN типа I (IFN-α / β) секретируются плазматическими дендритными клетками (pDC), в то время как IFN типа II (IFN-γ) преимущественно продуцируются естественными клетками-киллерами и в меньшей степени Т-клетками и макрофагами (24–26) .ИФН типа I и типа II обладают множеством противовирусных эффектов, таких как индукция апоптоза инфицированных клеток и активация макрофагов, естественных киллеров (NK) и Т-лимфоцитов (24–26). Несколько исследований показали нарушение регуляции выработки IFN у пациентов с COVID-19 (14, 27, 28).

В поисках новых и мощных биомаркеров неблагоприятного исхода у пациентов с COVID-19 мы проанализировали возможности ответа иммунной системы с помощью in vitro, стимуляции как клеток адаптивного, так и врожденного иммунитета, таким образом эффективно имитируя вирусную инфекцию.Действительно, in vitro стимуляция клеток врожденного и адаптивного иммунитета, как ранее было показано, может прогнозировать худший исход при других связанных с иммунитетом заболеваниях (29, 30), но, насколько нам известно, еще не исследована у пациентов с COVID-19. В этом проспективном одноцентровом исследовании мы сравнили функцию клеток врожденного и адаптивного иммунитета у пациентов с COVID-19 с легкой, умеренной или тяжелой формой заболевания, чтобы подчеркнуть механизм, ответственный за нарушение регуляции иммунного ответа.

Материалы и методы

Дизайн исследования и популяция

Мы провели проспективное когортное исследование в Университетской больнице Ниццы. Критериями включения были: (1) все взрослые пациенты, поступившие по поводу COVID-19 в консультационное отделение (отделение дерматологии или инфекционных заболеваний), в отделения инфекционных болезней или в отделение интенсивной терапии университетской больницы Ниццы с марта по апрель 2020 года; (2) отсутствие иммуносупрессивной терапии в течение 6 месяцев до включения; (3) возможность подписать информированное согласие.Критериями исключения были: (1) все пациенты до 18 лет; (2) пациенты, находящиеся под стражей, в тюрьме или страдающие психическим заболеванием; (3) беременные или кормящие грудью; (4) с известным иммунодефицитом или получавшим ранее иммуносупрессивную терапию. Было также набрано 50 здоровых доноров, не инфицированных SARS-CoV-2 (подтверждено отрицательным серологическим тестом).

В зависимости от тяжести заражения SARS-CoV-2 пациенты были разделены на три группы: (а) пациенты с тяжелой формой COVID-19 были госпитализированы или переведены в отделение интенсивной терапии с респираторной недостаточностью или дыхательной недостаточностью. требующие искусственной вентиляции легких или полиорганной недостаточности; (b) пациенты с COVID-19 средней тяжести — это пациенты, госпитализированные в отделения инфекционных болезней, в зависимости от клинических симптомов, связанных с одышкой, и радиологических данных о пневмонии при КТ грудной клетки; (c) Пациенты с COVID-19 с легкими симптомами COVID, такими как обморожение пальцев рук и ног или гриппоподобные симптомы, не требующие наблюдения в больнице.У всех пациентов была выявлена ​​симптоматика COVID-19 в соответствии с классификацией ВОЗ с помощью компьютерной томографии, характерной для COVID-19 (31) или обморожения (32), или двух последовательных положительных тестов RT-PCR на SARS-CoV-2 на образцах верхних и нижних дыхательных путей. (мазок из носоглотки или инвазивный респираторный образец) или положительный серологический тест (Euroimmun® ELISA).

Эпидемиологические, биологические и клинические данные на день 0 (D0) представлены в таблице 1 и дополнительной таблице 1. Лечение (а), полученное после D0, обобщено в дополнительной таблице 2.Осложнения определялись как все нежелательные явления, такие как госпитализация в отделение интенсивной терапии после ухудшения симптомов, искусственная вентиляция легких, тромбоз глубоких вен, вторичная бактериальная инфекция, почечная недостаточность, гепатит, сердечная недостаточность и смерть.

Таблица 1 . Демографические и исходные характеристики здоровых доноров и пациентов с COVID-19.

Информированное согласие было получено для всех пациентов. Протокол исследования соответствовал этическим принципам Хельсинкской декларации 1975 года и был одобрен соответствующим институциональным комитетом по обзору (NCT04355351).

Сбор крови и анализ цитокинов

Образцы крови были собраны в D0 и в несколько контрольных точек в срок до 2 месяцев после поступления в больницу. Один миллилитр цельной крови стимулировали иммунными лигандами (анти-CD3 в качестве стимулятора Т-клеток и R848 в качестве агониста Toll-подобных рецепторов 7/8 (TLR 7/8)) на отдельных лиофилизированных сферах (LyoSphere TM , Qiagen) в течение 8 ч после сбора крови. Образцы стимулированной крови инкубировали в течение 16–24 ч при 37 ° C, а затем центрифугировали при 2000–3000 × g в течение 15 мин для сбора стимулированной сыворотки.Нестимулированные сыворотка и плазма, а также стимулированная сыворотка хранили при -20 ° C до минимизации циклов анализа и замораживания-оттаивания для сохранения качества образцов. Уровни цитокинов в сыворотке и плазме крови с неспецифической стимуляцией или без нее измеряли с помощью теста QuantiFERON-Monitor для обнаружения IFN-γ или специально разработанных картриджей Ella (ProteinSimple) для обнаружения IL-1β, IL-6, IL-8, IL-10, IL-17A, TNF-α и IFN-α в соответствии с инструкциями производителя.

Исследования

in vitro

Для 18 пациентов с COVID-19 один миллилитр цельной крови, взятой в D0, был предварительно обработан различными молекулами в течение 6 часов при 37 ° C с последующей стимуляцией иммунными лигандами на отдельных лиофилизированных сферах (LyoSphere TM , Qiagen), как описано в разделе «Сбор крови и анализ цитокинов».Использовались молекулы, которые обычно вводили пациентам с COVID-19 (33–43): гидроксихлорохин (100 мкМ, Inresa), тоцилизумаб против IL6 (100 мкг / мл, RoActemra, Roche), метилпреднизолон (20 мкг / мл, Mylan). , адалимумаб против TNFα (10 мкг / мл, Humira, AbbVie), рекомбинантный человеческий IL-2 (6 нг / мл, Sigma), рекомбинантный человеческий IFN-альфа (100 нг / мл, Sigma) и ниволумаб (1 мкг / мл , Opdivo, Bristol Myers Squibb).

Статистика

Для описательной статистики данные представлены в виде среднего и стандартного отклонения для непрерывных значений с гауссовым распределением, в виде медианы и диапазона для непрерывных значений с негауссовым распределением, а также в виде количества и процентов для категориальных переменных.Тест нормальности Д’Агостино и Пирсона использовался для определения того, имеет ли переменная гауссово распределение или нет. Группы непрерывных значений сравнивали с помощью теста Манна-Уитни, однофакторного дисперсионного анализа (> 2 групп) или теста Краскела-Уоллиса (> 2 групп). Множественные сравнительные тесты были выполнены с тестом Краскела-Уоллиса с использованием апостериорного теста Данна . Категориальные переменные сравнивались с использованием критерия хи-квадрат. Кривая AUC (площадь под кривой) ROC (рабочая характеристика приемника) использовалась для определения порога IFN-γ, который наилучшим образом определяет пациентов с осложнениями или без них.Для сравнения данных о выживаемости использовался лог-ранговый тест. Для сравнения двух измерений непрерывной переменной, выполненных на одних и тех же испытуемых (парные данные), использовался знаковый ранговый критерий Уилкоксона для согласованных пар. Логистическая регрессия была проведена для определения отношений ODDS и 95% доверительных интервалов (ДИ). В многомерной модели мы скорректировали возраст, пол и ИМТ.

Статистический анализ выполняли с использованием GraphPad Prism 7.0 (GraphPad Software, Inc., Сан-Диего, Калифорния) или SAS 9.4. Все сравнения были двусторонними, и различия считались значимыми, когда значение P <0.05.

Результаты

Когорта исследования

Всего 101 пациент с симптоматикой инфекции COVID-19 (таблица 1) был включен и разделен на три группы в зависимости от тяжести их симптомов на легкие ( n = 41), умеренные ( n = 30). и тяжелые случаи ( n = 30), как описано в Методах. Также было привлечено 50 здоровых доноров. Как описано ранее (1, 3, 4), наблюдалась значительная разница в возрасте, поле, ИМТ и количестве сопутствующих заболеваний среди трех групп пациентов ( p <0.0001, p = 0,0002, p = 0,0003 и p = 0,0018 соответственно). Наиболее частые симптомы инфекции COVID-19 включали кашель, одышку и лихорадку у 52, 52 и 42% пациентов соответственно (дополнительная таблица 1).

Уровни цитокинов в нестимулированной плазме

Как и ожидалось, более высокие уровни провоспалительных цитокинов IL1β, IL6, IL8 и TNFα в плазме крови при поступлении и до специального лечения положительно коррелировали с тяжестью симптомов COVID-19 ( p <0.0001 для всех цитокинов) (таблица 2), что подтверждает результаты предыдущих исследований (3, 16–18).

Таблица 2 . Исходные уровни нестимулированных цитокинов в плазме здоровых доноров и пациентов с COVID-19.

Уровни цитокинов в сыворотке после

in vitro Неспецифическая стимуляция клеток врожденного и адаптивного иммунитета

Хотя текущее состояние воспалительного ответа на инфекцию SARS-CoV-2, о чем свидетельствуют уровни цитокинов в плазме, отражает продолжающееся взаимодействие между врожденным и адаптивным иммунитетом, оно мало что говорит нам об иммунной функции.С этой целью мы стимулировали врожденные клетки и Т-лимфоциты пациентов с COVID-19 при поступлении и перед специфическим лечением агонистом Toll-подобного рецептора 7/8 (TLR 7/8) и анти-CD3, соответственно, и измеряли секретируемые цитокины. . TLR7 преимущественно экспрессируется в плазматических дендритных клетках (pDC) (44), а TLR8 сильнее экспрессируется в миелоидных дендритных клетках, моноцитах и ​​в меньшей степени в pDC (45). Цитокин Th27 IL17A, а также IFN I и II типов не обнаруживались в нестимулированной плазме пациентов с COVID-19 (таблица 2).Однако после стимуляции in vitro иммунных клеток между пациентами с разной степенью тяжести COVID-19 возникли значительные различия в уровнях цитокинов (таблица 3, рисунок 1), что отражает работоспособность их иммунной системы. Что касается врожденного иммунитета, DC и NK-клетки умеренных и тяжелых пациентов были функционально истощены, о чем свидетельствуют более низкие уровни IFNα (и IFNγ из NK-клеток) после стимуляции in vitro ( p <0,0001) (Рисунок 1A), поскольку ранее (46), и различия оставались значимыми после поправки на количество моноцитов ( p <0.0001 легкое против умеренного и легкое против тяжелого) (Рисунок 1B). Уровни IL6, который секретируется клетками как врожденного, так и адаптивного иммунитета, оставались неизменными между группами при стимуляции in vitro ( p = 0,1247) (рис. 1C). Что касается адаптивного иммунитета, функциональное истощение наблюдалось для лимфоцитов Th27, продуцирующих IL17A, у пациентов с тяжелой формой COVID-19 по сравнению с легкими формами и здоровыми субъектами ( p = 0,0004 и p = 0,002 соответственно) (рисунок 1D).Поразительно, что более низкая секреция IFNγ коррелировала с увеличением тяжести COVID-19 ( p <0,0001) (рис. 1E). Эта более низкая продукция IFNγ оставалась значимой даже после поправки на количество лимфоцитов ( p = 0,0183 легкое против умеренного и p = 0,0009 легкое против тяжелого) (Рисунок 1F).

Таблица 3 . Уровни цитокинов в сыворотке после неспецифической стимуляции Т-лимфоцитов и ДК у здоровых доноров и у пациентов с COVID-19 на исходном уровне.

Рисунок 1 . Уровни цитокинов в сыворотке крови после стимуляции in vitro клеток врожденного и адаптивного иммунитета у здоровых субъектов и у пациентов с COVID-19 с легкими, умеренными или тяжелыми симптомами. Уровни IFNα ( A : при COVID-19 легкой степени не хватает 3 баллов, при COVID-19 средней степени тяжести — 3 балла, а у пациентов с тяжелой формой COVID-19 — 6 баллов), IL6 ( C : 3, 3 , и 6 баллов соответственно), IL17 ( D ; 3, 7 и 9 баллов соответственно) и IFNγ ( E : 2, 3 и 9 баллов соответственно), а также уровни IFNα и IFNγ были скорректированы на количество моноцитов (B) и лимфоцитов (F) соответственно.Различия между группами сравнивали с помощью теста Краскела-Уоллиса, используя апостериорный тест Данна .

Корреляция между продукцией IFNs после

in vitro Стимуляция и осложнения, связанные с COVID-19

Уровень продукции IFNα и IFNγ при стимуляции in vitro клеток врожденного и адаптивного иммунитета при поступлении и до специфического лечения был предиктором риска осложнений ( p = 0,003 и p <0.0001 соответственно) (Рисунки 2А, В). Действительно, пациенты с уровнем IFNα и IFNγ ниже 2,1 пг / мл и 15 МЕ / мл соответственно, как определено кривой ROC (данные не показаны), с большей вероятностью разовьются осложнения во время госпитализации ( p = 0,0098 и p = 0,0002 соответственно) (Рисунки 2B, D). Как подтверждается также многопараметрическим анализом (таблица 4), стимулированные уровни IFNγ являются независимым предиктором осложнений у пациентов с COVID-19 [ p = 0,0349 OR = 0.98 (0,962; 0,999)].

Рисунок 2 . Прогностическая ценность IFNα и IFNγ после неспецифической стимуляции клеток врожденного и адаптивного иммунитета для пациентов с COVID-19. Уровень IFNα ( A ; n = 55) и IFNγ ( C ; n = 89) различается у пациентов с осложнениями и без них и позволяет прогнозировать выживаемость без осложнений для пациентов с COVID-19. (Б, Д) . Различия между группами сравнивали с помощью критерия Манна-Уитни, а для сравнения данных о выживаемости использовали лог-ранговый критерий.

Таблица 4 . Многопараметрический анализ для оценки взаимосвязи между рассматриваемыми переменными на исходном уровне и осложнениями.

Эволюция уровней цитокинов в зависимости от клинического результата

Мы дополнительно оценили эволюцию продукции цитокинов и ответа на IFN во время госпитализации в умеренных и тяжелых случаях. Во время последующего наблюдения уровни нестимулированного ИЛ6 в плазме снизились между моментом поступления в больницу и последним перенесенным наблюдением для пациентов с благоприятным исходом ( p = 0.02148) (Рисунок 3A и дополнительный рисунок 1A), в то время как они оставались высокими у умерших пациентов ( p = 0,5625) (рисунок 3B и дополнительный рисунок 1B). Однако уровень IFNγ после стимуляции in vitro существенно не отличался между временем поступления в больницу и последней наблюдаемой временной точкой (рисунки 3C, D), что, вероятно, было связано с небольшим количеством пациентов в группе. . Были выбраны два индивидуальных случая, чтобы лучше продемонстрировать эволюцию продукции цитокинов в течение болезни.Первый случай привел к выздоровлению с повышенными уровнями стимулированного IFNγ в последней точке (дополнительный рисунок 1A), в то время как второй случай привел к смерти со стабильно низкими уровнями стимулированного IFNγ на протяжении всей госпитализации (дополнительный рисунок 1B).

Рисунок 3 . Эволюция уровней цитокинов у отдельных пациентов после их клинического исхода. Уровни IL6 в нестимулированной плазме ( A, B ; n = 13 и n = 6 соответственно) и уровни IFNγ после in vitro неспецифической стимуляции клеток врожденного и адаптивного иммунитета ( C, D ; n = 6 и n = 3, соответственно) сравнивались между пациентами, вылечившимися от инфекции SARS-CoV-2 (A, C) , и умершими пациентами (B , Г) .Различия между группами сравнивали с помощью знакового рангового критерия Уилкоксона для согласованных пар.

Влияние

in vitro Лечение терапевтическими молекулами на восстановление баланса цитокинов

Несколько препаратов, обычно используемых для лечения пациентов с COVID-19, были протестированы на их способность восстанавливать баланс цитокинов in vitro , в частности, увеличивать продукцию IFNγ и снижать продукцию воспалительных цитокинов, сохраняя при этом постоянную секрецию регуляторных цитокинов.Хлорохин и метилпреднизолон оказались эффективными в снижении секреции всех цитокинов (рис. 4), в то время как адалимумаб снижал секрецию только IL6 и IL10. Интересно, что IFNα имел более сбалансированный эффект с сильной стимуляцией IFNγ и уменьшением воспалительного цитокина IL1β, в то время как секреция Т-регуляторного цитокина IL10 и провоспалительного цитокина (IL6) оставалась неизменной. Отдельные результаты подробно представлены в дополнительной таблице 3.

Рисунок 4 . Эффективность лечения in vitro различными препаратами, обычно используемыми при COVID-19 для модуляции экспрессии цитокинов.Уровни IFNγ (A) , IL1β (B) , IL6 (C) и IL10 (D) после предварительной обработки лекарствами in vitro с последующей неспецифической стимуляцией врожденных и адаптивных иммунные клетки у 18 пациентов с COVID-19. Различия между группами сравнивали с помощью теста Краскела-Уоллиса, используя апостериорный тест Данна .

Обсуждение

Мы сообщаем здесь о когорте из 101 пациента с симптоматикой инфекции COVID-19. Мы стремились выявить их специфические иммунологические профили и сопоставить их с развитием и степенью симптомов у отдельных пациентов.Наши результаты подтвердили функциональное истощение продукции типа I (NK-клетки и DC) и IFN (T-клетки) типа II у умеренных и тяжелых пациентов, что приводит к уклонению от врожденного и адаптивного иммунного ответа, и в соответствии с недавними исследованиями (14, 16, 18, 21, 47–49).

Хорошо известно, что врожденный иммунный ответ запускается инфицированными вирусом клетками, которые могут распознаваться рецепторами распознавания паттернов хозяина (PRR), экспрессируемыми DC, которые продуцируют различные цитокины (50), такие как IFN типа I, которые в поверните рекрут лимфоцитов и моноцитов в воспаленные участки (51–54).IFN типа I в первую очередь активирует эпителиальные клетки и снижает провоспалительную активность, опосредованную мононуклеарными макрофагами (55). IFN типа II имеют разные функции, вызывая иммунные ответы, управляемые T-хелпером 1 (Th2), а также позволяя индуцированным регуляторным T (Treg) -клеткам контролировать и регулировать иммунные ответы (56). Следовательно, SARS-CoV-2 развил несколько механизмов, чтобы ингибировать индукцию IFN типа I и передачу сигналов (57). Во время инфекции SARS-CoV-2 для успешного уничтожения вируса требуется как врожденный, так и адаптивный иммунный ответ, и их необходимо адекватно контролировать, чтобы минимизировать иммунопатологическое повреждение (57).Оценивая ответ иммунных клеток инфицированных пациентов после стимуляции, мы демонстрируем здесь заметное снижение ответа IFN типа I и типа II от легких до тяжелых пациентов. Молекулярный механизм (ы) этого уклонения от IFN еще предстоит подтвердить, однако несколько исследований предложили различные пути, которые могут способствовать снижению количества IFN у пациентов с тяжелой формой COVID-19, от скрытой вирусной продукции, невидимой для PPAR, до прямого синтеза структурные и неструктурные вирусные белки, которые противодействуют передаче сигналов IFN (47–49).Действительно, SARS-CoV-2 индуцировал аберрантный ответ IFN типа I в культивируемых клетках, характеризующийся отсроченным противовирусным ответом, который может обеспечивать окно для репликации вируса и неправильный набор популяций воспалительных макрофагов моноцитов (21).

Оригинальность нашей работы заключается в стимуляции TLR7 и TLR8, которые воспроизводят in vitro вирусную инфекцию путем активации врожденной иммунной системы и продуцируют IFN типа I (58). С другой стороны, стимуляция Т-лимфоцитов анти-CD3 позволила нам количественно оценить продукцию IFN типа II и оценить адаптивный иммунный ответ.Врожденное иммунное распознавание вирусной инфекции запускает противовирусные иммунные ответы остаточной геномной РНК, распознаваемой PRR, экспрессируемой в основном DC (59). У пациентов с COVID-19 средней и тяжелой степени тяжести мы наблюдали, что врожденные клетки вырабатывают меньше IFN типа I, и, следовательно, NK-клетки вырабатывают меньше IFN типа II. В соответствии с предыдущими исследованиями (21, 60) наши результаты показывают, что неконтролируемая инфекция поддерживает активацию моноцитов и макрофагов, а регуляторные Т-лимфоциты остаются инактивированными из-за слабой продукции IFN типа II, таким образом усиливая цитокиновый шторм и приводя к тяжелые осложнения у пациентов с COVID-19.

Это продольное исследование позволило нам сделать вывод, что функциональный анализ продукции IFN в начале госпитализации является мощным инструментом для прогнозирования клинической эволюции пациентов, инфицированных SARS-CoV-2. В то время как предыдущие исследования продемонстрировали противоположные результаты с нарушением (14, 28) или повышенным (61) ответом на IFN типа I у пациентов с тяжелой формой COVID-19, наши результаты склоняют чашу весов в сторону нарушения передачи сигналов IFN. Согласно нашему исследованию стимулированного производства IFN, а также другим исследованиям (14, 21), IFN типа I играет важную роль в активации IFN типа II и представляет собой стратегическую цель для раннего лечения пациентов с COVID-19, чтобы для уничтожения иммунного уклонения, вызванного SARS-CoV-2, и для лечения специфической иммунной дисфункции.

Однако появляется все больше доказательств того, что пациенты с тяжелой формой COVID-19 могут иметь устойчивый ответ на IFN типа I, который контрастирует с отсроченным, возможно, подавленным ответом на IFN, наблюдаемым на ранней стадии инфекции (27, 62). Ограничиваясь небольшим размером выборки из восьми и семи пациентов соответственно, Zhou et al. и Wilk et al. продемонстрировали, что многие IFN-стимулированные гены сверхэкспрессируются у пациентов с COVID-19 (62, 63).

Поскольку необходимы дополнительные исследования для дальнейшего изучения роли IFN в COVID-19, как с клинической, так и с молекулярной точки зрения, лечение IFN также остается спорным.Тем не менее, исследование in vitro на культивируемых клетках показало потенциальную пользу лечения IFNβ (48), а также недавнее клиническое исследование NCT04276688 с благоприятным исходом для IFNβ (33), в то время как другие все еще продолжаются. Два недавних ретроспективных исследования показали, что лечение IFNα может быть полезным для пациентов с COVID-19 (37, 38), однако кажется, что адекватное время введения IFN имеет решающее значение для его эффективности, поскольку раннее введение снижает смертность, в то время как позднее введение имеет противоположный эффект ( 38).

Наше исследование имеет несколько ограничений. Во-первых, это обсервационное исследование, показывающее связь между уровнями IFN I и II и тяжестью COVID-19 и исходом. Рандомизированные клинические испытания с использованием функционального анализа интерферона при поступлении для прогнозирования исхода необходимы для четкой оценки эффективности и полезности измерения интерферона в клинической практике. Во-вторых, хотя наши тесты in vitro, и несколько недавно опубликованных исследований (33, 37, 38, 48) показывают потенциал лечения IFNα для восстановления цитокинового баланса, результаты, тем не менее, должны быть подтверждены в крупных контролируемых клинических испытаниях.В-третьих, это исследование на относительно небольшом количестве пациентов, которое необходимо подтвердить в более крупных когортах. Примечательно, что в нашей когорте пациентов с COVID-19 было всего шесть смертей, что серьезно ограничивает возможности статистического анализа. В-четвертых, хотя было показано, что мужской пол, пожилой возраст и ожирение тесно связаны с повышенной смертностью пациентов с COVID-19 (10, 11), низкое количество смертей не позволило нам определить эти факторы в нашей когорте. Вместо этого мы проверили прогностическую силу возраста, пола и ИМТ в отношении осложнений, связанных с COVID-19, но, кроме уровней IL6 в плазме и стимулированных уровней IFNγ, другие переменные оставались незначимыми при многомерном анализе.

Изменчивость симптоматики лежит в основе наших клеток среди иммунных реакций, участвующих в борьбе с инфекцией COVID-19. IFNγ представляет собой прогностический биомаркер эволюции SARS-CoV-2, который можно безопасно и регулярно измерять в лаборатории с помощью QuantiFERON Monitor. Это могло бы позволить клиницистам обеспечить скорректированное лечение и медицинскую помощь в этом эпидемическом контексте. Основываясь на наших результатах, наш функциональный тест может быть важным инструментом для прогнозирования тяжелой формы COVID-19 и руководства персонализированной терапией, направленной на восстановление иммунной системы NK и T-клеток (ингибиторы контрольных точек) и выработку IFN.

Заявление о доступности данных

Необработанные данные, подтверждающие выводы этой статьи, будут предоставлены авторами без излишних оговорок.

Заявление об этике

Исследования с участием людей были рассмотрены и одобрены CPP SUD-OUEST et OUTRE-MER I. Пациенты / участники предоставили письменное информированное согласие на участие в этом исследовании.

Авторские взносы

CR, VB, MC, SB и BS-P разработали исследование.В.Б. и М.К. проводили эксперименты. KZ, CF, CR и MC собирали клинические данные. BS-P, CR, VB и MC проанализировали и интерпретировали данные. BS-P, CR, ED, KR, JC, EC, CI, JD и TP обеспечивали медицинский надзор. BS-P, CR и VB подготовили и отредактировали рукопись. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Это исследование было поддержано грантом Департамента приморских Альп и Национальным агентством исследований (ANR).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы благодарим всех пациентов, участвовавших в этом исследовании, а также Элоди Малле, Жеральдин Дальмассо и Наталью Шозену за их помощь в лаборатории.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https: // www.frontiersin.org/articles/10.3389/fmed.2020.603961/full#supplementary-material

Список литературы

1. Ли Цюй, Гуань Х, Ву П, Ван Х, Чжоу Л., Тонг И и др. Динамика ранней передачи новой пневмонии, инфицированной коронавирусом, в Ухане, Китай. N Engl J Med. (2020) 382: 1199–207. DOI: 10.1056 / NEJMoa2001316

PubMed Аннотация | CrossRef Полный текст | Google Scholar

2. Чжоу П., Ян Х Лу, Ван XG, Ху Б., Чжан Л., Чжан В. и др. Вспышка пневмонии, связанная с новым коронавирусом, вероятно, происхождения летучих мышей. Природа. (2020) 579: 270–3. DOI: 10.1038 / s41586-020-2951-z

PubMed Аннотация | CrossRef Полный текст | Google Scholar

3. Хуанг Ц., Ван И, Ли Х, Рен Л., Чжао Дж, Ху И и др. Клинические особенности пациентов, инфицированных новым коронавирусом 2019 г., в Ухане, Китай. Ланцет. (2020) 395: 497–506. DOI: 10.1016 / S0140-6736 (20) 30183-5

PubMed Аннотация | CrossRef Полный текст | Google Scholar

4. Гуань В.Дж., Ни З.Й., Ху Й., Лян У.Х., Оу С.К., Хе Дж. Х и др.Клиническая характеристика коронавирусной болезни 2019 в Китае. N Engl J Med . (2020) 382: 1708–20. DOI: 10.1056 / NEJMoa2002032

CrossRef Полный текст | Google Scholar

5. Jin YH, Cai L, Cheng ZS, Cheng H, Deng T., Fan YP и др. Краткое руководство по диагностике и лечению пневмонии, инфицированной новым коронавирусом 2019 года (2019-nCoV) (стандартная версия). Mil Med Res. (2020) 7: 1–23. DOI: 10.1186 / s40779-020-0233-6

CrossRef Полный текст

6.Wu Z, McGoogan JM. Характеристики и важные уроки вспышки коронавирусного заболевания 2019 г. (COVID-19) в Китае: краткое изложение отчета Китайского центра по контролю и профилактике заболеваний о 72314 случаях. J Am Med Assoc. (2020) 323: 1239–42. DOI: 10.1001 / jama.2020.2648

PubMed Аннотация | CrossRef Полный текст | Google Scholar

8. Хэнли Б., Нареш К.Н., Руфосс С., Николсон А.Г., Вейр Дж., Кук Г.С. и др. Гистопатологические данные и вирусный тропизм у британских пациентов с тяжелым смертельным исходом COVID-19: посмертное исследование. Ланцетный микроб. (2020) 1: e245–53. DOI: 10.1016 / S2666-5247 (20) 30115-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

9. Лю К., Фанг Й.Й., Дэн Й., Лю В., Ван М.Ф., Ма Дж. П. и др. Клиническая характеристика случаев нового коронавируса в больницах третичного уровня провинции Хубэй. Chin Med J. (2020) 133: 1025–31. DOI: 10.1097 / CM9.0000000000000744

CrossRef Полный текст | Google Scholar

10. Гун Дж, Оу Дж, Цю Х, Цзе Й, Чен Й, Юань Л. и др.Инструмент для раннего прогнозирования тяжелой коронавирусной болезни 2019 (COVID-19): многоцентровое исследование с использованием номограммы риска в Ухане и Гуандуне, Китай. Clin Infect Dis . (2020) 71: 833–40. DOI: 10.1093 / cid / ciaa443

PubMed Аннотация | CrossRef Полный текст | Google Scholar

11. Чен X, Лю З. Раннее прогнозирование риска смертности среди пациентов с тяжелой формой COVID-19 с использованием машинного обучения. Int J Epidemiol . (2020) 42: dyaa171. DOI: 10.1093 / ije / dyaa171

CrossRef Полный текст | Google Scholar

12.Карвелли Дж., Демария О., Вели Ф., Батиста Л., Бенмансур, Северная Каролина, Фарес Дж. И др. Ассоциация воспаления COVID-19 с активацией оси C5a – C5aR1. Природа . (2020) 588: 146–50. DOI: 10.1038 / s41586-020-2600-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

13. Вабрет Н., Бриттон Дж. Дж., Грубер С., Хегде С., Ким Дж., Куксин М. и др. Иммунология COVID-19: современное состояние науки. Иммунитет . (2020) 52: 910–41.

PubMed Аннотация | Google Scholar

14.Hadjadj J, Yatim N, Barnabei L, Corneau A, Boussier J, Pere H и др. Нарушение активности интерферона I типа и обострение воспалительных реакций у пациентов с тяжелым Covid-19. Наука (80-) . (2020) 369: 718–24. DOI: 10.1126 / science.abc6027

PubMed Аннотация | CrossRef Полный текст | Google Scholar

15. Фей Дж, Фу Л, Ли И, Сян Х. Х, Сян И, Ли М-Д и др. Уменьшение количества лимфоцитов на ранней стадии повышает тяжесть и риск смерти пациентов с COVID-19: когортное исследование на базе больниц. MedRxiv . (2020). DOI: 10.1101 / 2020.04.02.20050955

CrossRef Полный текст | Google Scholar

17. Johannessen LE, Pedersen NM, Pedersen KW, Madshus IH, Stang E. Активация рецептора эпидермального фактора роста (EGF) индуцирует образование покрытых клатрином ямок, содержащих рецептор EGF и Grb2. Mol Cell Biol. (2006) 26: 389–401. DOI: 10.1128 / MCB.26.2.389-401.2006

PubMed Аннотация | CrossRef Полный текст | Google Scholar

19.Рагаб Д., Салах Элдин Х., Тейма М., Хаттаб Р., Салем Р. Цитокиновый шторм COVID-19: что мы знаем до сих пор. Front Immunol. (2020) 11: 1–4. DOI: 10.3389 / fimmu.2020.01446

PubMed Аннотация | CrossRef Полный текст

20. Чен Г., Ву Д., Го В., Цао И, Хуанг Д., Ван Х и др. Клинические и иммунологические особенности при тяжелой и умеренной коронавирусной болезни 2019. J Clin Invest . (2020) 130: 2620–9. DOI: 10.1101 / 2020.02.16.20023903

PubMed Аннотация | CrossRef Полный текст | Google Scholar

21.Бланко-Мело Д., Нильссон-Пайант Б. Э., Лю В. К., Уль С., Хоагланд Д., Мёллер Р. и др. Несбалансированная реакция хозяина на SARS-CoV-2 способствует развитию COVID-19. Ячейка . (2020) 181: 1036–45. DOI: 10.1016 / j.cell.2020.04.026

PubMed Аннотация | CrossRef Полный текст | Google Scholar

23. Du SQ, Yuan W. Математическое моделирование взаимодействия между врожденными и адаптивными иммунными ответами при COVID-19 и их значение для вирусного патогенеза. J Med Virol . (2020) 92: 1615–28.DOI: 10.1002 / jmv.25866

PubMed Аннотация | CrossRef Полный текст | Google Scholar

24. Вивье Э., Томаселло Э., Баратин М., Вальцер Т., Уголини С. Функции естественных клеток-киллеров. Nat Immunol. (2008) 9: 503–10. DOI: 10.1038 / ni1582

CrossRef Полный текст | Google Scholar

25. Бонжардим CA. Интерфероны (IFN) являются ключевыми цитокинами как в врожденном, так и в адаптивном противовирусном иммунном ответе, а вирусы противодействуют действию IFN. Microbes Infect. (2005) 7: 569–78. DOI: 10.1016 / j.micinf.2005.02.001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

26. Жесткий DF. Интерферон I типа как связующее звено между врожденным и адаптивным иммунитетом посредством стимуляции дендритных клеток. Leuk Лимфома. (2004) 45: 257–64. DOI: 10.1080 / 104281

  • 00149368

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    29. Бойер-Суавет С., Кремони М., Дупейрат Т., Зорзи К., Брглез В., Бензакен С. и др.Функциональный иммунный анализ с использованием гамма-интерферона может предсказать инфекционные события в терминальной стадии заболевания почек. Clin Chim Acta. (2019) 502: 287–92. DOI: 10.1016 / j.cca.2019.11.018

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    31. Хорнусс Д., Лаубнер К., Монастерио С., Тимме Р., Вагнер Д. [COVID-19-ассоциированная пневмония, несмотря на неоднократные отрицательные результаты ПЦР-анализа мазков из ротоглотки]. Dtsch Med Wochenschr . (2020) 145: 844–9. DOI: 10.1055 / a-1170-6061

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    32.Bouaziz JD, Duong T, Jachiet M, Velter C, Lestang P, Cassius C и др. Сосудистые кожные симптомы при COVID-19: французское обсервационное исследование. J Eur Acad Dermatol Venereol . (2020) 34: e451–2. DOI: 10.1111 / jdv.16544

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    33. Hung IFN, Lung KC, Tso EYK, Liu R, Chung TWH, Chu MY, et al. Тройная комбинация интерферона бета-1b, лопинавира – ритонавира и рибавирина в лечении пациентов, госпитализированных с COVID-19: открытое рандомизированное исследование фазы 2. Ланцет. (2020) 395: 1695–704. DOI: 10.1016 / S0140-6736 (20) 31042-4

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    34. Виджайваргия П., Эскер Гарригос З., Кастильо Алмейда, NE, Гуррам ПР, Стивенс Р.В., Разонабл Р.Р. Рекомендации по лечению COVID-19: критический обзор доказательств (или их отсутствия). Mayo Clin Proc. (2020) 95: 1454–66. DOI: 10.1016 / j.mayocp.2020.04.027

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    35.Коллективная группа RECOVERY. Дексаметазон у госпитализированных пациентов с Covid-19 — предварительное сообщение. N Engl J Med . (2020). [Epub перед печатью].

    Google Scholar

    37. Чжоу К., Чен В., Шеннон С.П., Вэй XS, Сян Х, Ван Х и др. Лечение COVID-19 интерфероном-α2b. Front Immunol. (2020) 11: 1–6. DOI: 10.3389 / fimmu.2020.615275

    CrossRef Полный текст | Google Scholar

    38. Ван Н, Чжан И, Чжу Л., Хоу З, Лю Ф, Сун П. и др.Ретроспективное многоцентровое когортное исследование показывает, что ранняя терапия интерфероном связана с благоприятным клиническим ответом у пациентов с COVID-19. Клеточный микроб-хозяин. (2020) 28: 455–64.e2. DOI: 10.1016 / j.chom.2020.07.005

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    39. Вирсинга В.Дж., Родос А., Ченг А.С., Пикок С.Дж., Прескотт ХК. Патофизиология, передача, диагностика и лечение коронавирусной болезни 2019 (COVID-19): обзор. JAMA — J Am Med Assoc. (2020) 324: 782–93. DOI: 10.1001 / jama.2020.12839

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    40. Ризк Дж. Г., Калантар-Заде К., Мехра М. Р., Лави С. Дж., Ризк И., Фортал Д. Н.. Фармако-иммуномодулирующая терапия при COVID-19. Наркотики. (2020) 80: 1267–92. DOI: 10.1007 / s40265-020-01367-z

    CrossRef Полный текст | Google Scholar

    41. Сабадош Б., Абу-Ганем Ю., Грант М., Чой Дж., Бекс А., Поулз Т. Клинические характеристики и исход для четырех больных раком, инфицированных SARS-CoV-2, которых лечили ингибиторами иммунных контрольных точек. Eur Urol. (2020) 78: 276–80. DOI: 10.1016 / j.eururo.2020.05.024

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    43. Саадун Д., Розенцвайг М., Джоли Ф., Сикс А., Каррат Ф., Тибо В. и др. Регуляторные Т-клеточные ответы на низкие дозы интерлейкина-2 при ВГС-индуцированном васкулите. N Engl J Med. (2011) 365: 2067–77. DOI: 10.1056 / NEJMoa1105143

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    44. Патинот С., Каррум Н.Б., Моарбесс Г., Чирнат Н., Кассаб И., Боннет П.А. и др.Лиганды-агонисты и антагонисты толл-подобных рецепторов 7 и 8: оригинальные инструменты для терапевтических целей. Eur J Med Chem. (2020) 193: 112238. DOI: 10.1016 / j.ejmech.2020.112238

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    45. Крозат К., Вивье Э., Далод М. Перекрестное взаимодействие между компонентами врожденной иммунной системы: повышение антимикробной защиты и предотвращение иммунопатологий. Immunol Rev. (2009) 227: 129–49. DOI: 10.1111 / j.1600-065X.2008.00736.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    46. Zheng M, Gao Y, Wang G, Song G, Liu S, Sun D и др. Функциональное истощение противовирусных лимфоцитов у пациентов с COVID-19. Cell Mol Immunol. (2020) 17: 533–5. DOI: 10.1038 / s41423-020-0402-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    48. Лэй Х, Донг Х, Ма Р, Ван В., Сяо Х, Тиан Зи и др. Активация и уклонение от ответа на интерферон I типа SARS-CoV-2. Nat Commun. (2020) 11: 1–12. DOI: 10.1038 / s41467-020-17665-9

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    52. Ито Т., Ван Ю.Х., Лю Ю.Дж. Плазмацитоидные предшественники дендритных клеток / клетки, продуцирующие интерферон I типа, обнаруживают вирусную инфекцию с помощью Toll-подобного рецептора (TLR) 7 и TLR9. Springer Semin Immunopathol. (2005) 26: 221–9. DOI: 10.1007 / s00281-004-0180-4

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    53.Теофилопулос А.Н., Баккала Р., Бейтлер Б., Коно Д.Х. Интерфероны I типа (A / B) при иммунитете и аутоиммунитете. Annu Rev Immunol. (2005) 23: 307–35. DOI: 10.1146 / annurev.immunol.23.021704.115843

    CrossRef Полный текст | Google Scholar

    54. Фор Э., Пуасси Дж., Гоффард А., Фурнье С., Кипнис Э., Титекат М. и др. Отчетливый иммунный ответ у двух пациентов, инфицированных БВРС-КоВ: можем ли мы перейти от скамейки к постели? PLoS ONE. (2014) 9: e88716. DOI: 10.1371 / journal.pone.0088716

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    55. Дэвидсон С., МакКейб Т.М., Кротта С., Гад Х.Х., Хессель Е.М., Бинке С. и др. IFN λ является сильнодействующим противогриппозным лекарственным средством без побочных воспалительных эффектов лечения IFN α. EMBO Mol Med. (2016) 8: 1099–112. DOI: 10.15252 / emmm.201606413

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    57. Лагунас-Рангель Ф.А., Чавес-Валенсия V. Высокое соотношение IL-6 / IFN-γ может быть связано с тяжелым заболеванием у пациентов с COVID-19. J Med Virol . (2020) 92: 1789–90. DOI: 10.1002 / jmv.25900

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    58. Суд С., Кандалл Д., Ю Л., Миямасу М., Бойл Дж. С., Онг С.И. и др. Новый биомаркер иммунной функции и первоначальный опыт в популяции трансплантатов. Трансплантация. (2014) 97: 50–1. DOI: 10.1097 / TP.0000000000000078

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    60. Морейра-Тейшейра Л., Майер-Барбер К., Шер А., О’Гарра А.Интерфероны I типа при туберкулезе: враг, а иногда и друг. J Exp Med. (2018) 215: 1273–85. DOI: 10.1084 / jem.20180325

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    61. Лукас С., Вонг П., Кляйн Дж., Кастро ТБР, Сильва Дж., Сундарам М. и др. Продольный анализ выявляет иммунологические перебои в работе при тяжелой форме COVID-19. Природа. (2020) 584: 463–9. DOI: 10.1038 / s41586-020-2588-y

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    62.Zhou Z, Ren L, Zhang L, Zhong J, Xiao Y, Jia Z и др. Повышенный врожденный иммунный ответ в дыхательных путях у пациентов с COVID-19. Клеточный микроб-хозяин. (2020) 27: 883–90.e2. DOI: 10.1016 / j.chom.2020.04.017

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    63. Вилк А.Дж., Рустаги А., Чжао Н.К., Роке Дж., Мартинес-Колон Г.Дж., МакКечни Дж.Л. и др. Одноклеточный атлас периферического иммунного ответа у пациентов с тяжелой формой COVID-19. Nat Med. (2020) 26: 1070–6.DOI: 10.1038 / s41591-020-0944-y

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лейкоцитарный ИФН-α / β и эпителиальный ИФН-λ образуют отделенную систему защиты слизистой оболочки, которая ограничивает кишечные вирусные инфекции

    Abstract

    Эпителиальные клетки являются основным входом для многих вирусов, но молекулярные сети, которые защищают поверхности барьеров от вирусных инфекций, изучены не полностью. Вирусные инфекции вызывают одновременную продукцию интерферонов типа I (IFN-α / β) и типа III (IFN-λ).Считается, что все ядерные клетки отвечают на IFN-α / β, тогда как ответы IFN-λ в основном ограничиваются эпителиальными клетками. Мы наблюдали, что эпителиальные клетки кишечника, в отличие от кроветворных клеток этого органа, экспрессируют только очень низкие уровни функциональных рецепторов IFN-α / β. Соответственно, после перорального инфицирования мышей с дефицитом рецептора IFN-α / β человеческий реовирус типа 3 специфически инфицировал клетки собственной пластинки, но, что поразительно, не реплицировался продуктивно в эпителиальных клетках кишечника. Напротив, реовирус реплицируется почти исключительно в эпителиальных клетках кишечника мышей с дефицитом рецептора IFN-λ, что позволяет предположить, что слизистая оболочка кишечника оснащена компартментализированной системой IFN, в которой эпителиальные клетки в основном отвечают на IFN-λ, который они продуцируют после вирусной инфекции, тогда как другие клетки кишечника в основном полагаются на IFN-α / β для противовирусной защиты.У кормящих мышей с дефицитом рецептора IFN-λ реовирус реплицировался в эпителии кишечника и дополнительно инфицировал эпителиальные клетки, выстилающие желчные протоки, что указывает на то, что младенцы могут использовать IFN-λ для борьбы с вирусными инфекциями в различных тканях, богатых эпителием. Таким образом, IFN-λ следует рассматривать как автономную систему защиты от вирусов слизистой оболочки кишечника и других эпителиальных барьеров, которые, возможно, возникли, чтобы избежать излишне частого срабатывания системы IFN-α / β, которая может вызвать обострение воспаления.

    Сведения об авторе

    Интерферон, индуцированный вирусом, состоит из двух различных семейств молекул, IFN-α / β и IFN-λ. Члены семейства IFN-α / β являются ключевыми противовирусными молекулами, обеспечивающими защиту от большого количества вирусов, инфицирующих самые разные типы клеток. Напротив, ответы IFN-λ в основном ограничиваются эпителиальными клетками из-за сильно ограниченной экспрессии родственного рецептора. Интересно, что устойчивость эпителия кишечника к вирусам не зависит от IFN-α / β, а скорее зависит от IFN-λ, что ставит под сомнение преобладающее мнение о том, что рецепторы IFN-α / β экспрессируются повсеместно.Здесь мы демонстрируем, что система IFN-α / β неспособна компенсировать дефицит IFN-λ во время инфекций эпителиотропными вирусами, потому что эпителиальные клетки кишечника не экспрессируют функциональные рецепторы для IFN-α / β. Мы также демонстрируем, что инфицированные вирусом кишечные эпителиальные клетки являются мощными продуцентами IFN-λ, что указывает на то, что слизистая оболочка кишечника обладает компартментализированной системой IFN, в которой эпителиальные клетки преимущественно отвечают на IFN-λ, тогда как другие клетки кишечника в основном полагаются на IFN-λ. α / β для противовирусной защиты.Мы предполагаем, что IFN-λ, возможно, развился как автономная система защиты от вирусов слизистой оболочки кишечника, чтобы избежать излишне частого срабатывания системы IFN-α / β, которая из-за своей высокой активности на иммунные клетки может вызвать обострение воспаления.

    Образец цитирования: Mahlakõiv T, Hernandez P, Gronke K, Diefenbach A, Staeheli P (2015) Лейкоцитарный IFN-α / β и эпителиальный IFN-λ представляют собой отделенную систему защиты слизистой оболочки, которая ограничивает кишечные вирусные инфекции.PLoS Pathog 11 (4): e1004782. https://doi.org/10.1371/journal.ppat.1004782

    Редактор: Гарри Б. Гринберг, Стэнфордский университет, США

    Поступило: 13 августа 2014 г .; Одобрена: 3 марта 2015 г .; Опубликовано: 7 апреля 2015 г.

    Авторские права: © 2015 Mahlakõiv et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника

    Доступность данных: Все соответствующие данные находятся в пределах документ и вспомогательные информационные файлы к нему.

    Финансирование: Это исследование было частично поддержано Инициативой совершенства Федерального правительства и правительства земель (GSC-4, Spemann Graduate School) и Deutsche Forschungsgemeinschaft (SFB 620). (http://www.dfg.de). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что конкурирующих интересов не существует.

    Введение

    Кишечник должен поддерживать толерантность к симбиотической микрофлоре желудочно-кишечного тракта, одновременно обеспечивая эффективный иммунный ответ при заражении условно-патогенными бактериями или кишечными вирусами.Таким образом, слизистая оболочка кишечника, состоящая из выстилающего эпителия и лежащих в основе клеток собственной пластинки, образует первую линию защиты от патогенных микроорганизмов, попадающих в организм оральным путем.

    Семейство интерферонов типа I (IFN-α / β) представляет собой ключевой элемент врожденной противовирусной защиты [1–5]. У людей семейство IFN типа I включает 13 IFN-α, один IFN-β и несколько минорных подтипов IFN (IFN-κ / ε / ω), которые все связываются с одним гетеродимерным комплексом клеточной поверхности, известным как IFN-α / β. рецептор [6].Включение рецептора IFN-α / β активирует сигнальный путь Jak-STAT и индуцирует экспрессию нескольких сотен стимулированных IFN генов (ISG), многие из которых проявляют прямую противовирусную активность [7–10]. В 2003 году было открыто семейство IFN типа III (IFN-λ), включающее 3 аналогичные молекулы IFN-λ [11,12]. Быстро стало ясно, что индукция и механизм действия IFN-λ и IFN типа I очень похожи [13–16], хотя IFN-λ использует отдельный рецептор для передачи сигналов. Эти наблюдения подняли вопрос, почему могли возникнуть две, казалось бы, избыточные противовирусные системы.

    Основное различие между системами IFN-α / β и IFN-λ заключается в том, что экспрессия рецептора IFN-λ ограничена в основном эпителием слизистой оболочки, тогда как рецептор IFN-α / β, по-видимому, экспрессируется повсеместно [13]. Соответственно, мыши с дефицитом рецептора IFN-α / β проявляют повышенную чувствительность к большому количеству различных вирусов [2,4]. Напротив, мыши, лишенные функциональных рецепторов IFN-λ, довольно хорошо контролируют системные вирусные инфекции и лишь немного более восприимчивы к респираторным вирусам, чем мыши дикого типа [14,16].Интересно, что мыши с дефицитом как IFN-α / β, так и IFN-λ чрезвычайно чувствительны к различным респираторным вирусам, демонстрируя избыточность двух систем IFN в легких, богатых эпителиальными клетками [14].

    Значение системы IFN типа I для борьбы с кишечными вирусными инфекциями сильно варьируется в зависимости от вызывающего вируса. Например, IFN-α / β играет важную роль в ограничении вирусных заболеваний после пероральной инокуляции мышей полиовирусом или человеческими реовирусами, но он имеет умеренное значение в ограничении ротавируса, который проявляет высокий тропизм к эпителиальным клеткам кишечника [17– 23].Недавно мы продемонстрировали, что система IFN-λ важна для эффективного контроля репликации ротавируса в эпителиальных клетках кишечника [23]. Это открытие было неожиданным, учитывая тот факт, что рецепторы IFN-α / β, как полагают, экспрессируются на всех ядросодержащих клетках, и поднял вопрос о том, почему система IFN-α / β неспособна компенсировать дефицит IFN-λ в этом случае. .

    Мы демонстрируем здесь, что эпителиальные клетки кишечника экспрессируют только низкие уровни двух цепей рецепторного комплекса IFN-α / β, имеют низкую плотность рецепторов IFN-α / β на поверхности и, соответственно, очень плохо реагируют на стимуляцию. с IFN типа I.Интересно, что помимо сильного ответа на IFN-λ, эпителиальные клетки кишечника также легко продуцируют IFN-λ, но не IFN-α или IFN-β в ответ на вирусные триггеры, что позволяет предположить, что IFN-λ функционирует как автономный механизм противовирусной защиты в эпителии кишечника. который не требует помощи IFN типа I. Эксперименты с вирусным заражением мышей, лишенных функциональных рецепторов для IFN-α / β или IFN-λ, подтвердили концепцию разделенной системы IFN слизистой оболочки кишечника и подчеркнули исключительно доминирующую роль IFN-λ в противовирусной защите эпителиальных клеток кишечника и желчных протоков.

    Результаты

    Клетки кишечного эпителия демонстрируют низкий уровень экспрессии рецептора IFN-α / β и не реагируют на IFN типа I

    Чтобы ответить на вопрос, почему эпителий кишечника плохо защищен IFN типа I от инфицирования ротавирусом [23], мы измерили экспрессию гена рецептора IFN в изолированных эпителиальных клетках кишечника (IEC) и во фракциях лимфоцитов собственной пластинки (LAMINA) взрослых диких животных. тип мышей с помощью количественной ПЦР с обратной транскрипцией (RT-qPCR). Мы проанализировали чистоту выделенных клеточных фракций путем измерения экспрессии маркерных генов эпителиальных клеток ( Cdh2 , кодирующего E-кадгерин) и лейкоцитов ( Ptprc , кодирующего CD45) (S1A и S2 фиг.), А также с помощью проточной цитометрии с использованием антитела против CD45 и эпителиального маркера EpCAM (S1B фиг.).Как и ожидалось, Ifnlr1 и Il10r2 , кодирующие две цепи рецепторного комплекса IFN-λ, были высоко экспрессированы в IEC, но не в LPL (рис. 1A и S2). Оба компонента рецепторного комплекса IFN типа I, Ifnar1 и Ifnar2 , были высоко экспрессированы в LPL, которые, как хорошо известно, легко реагируют на IFN типа I. Напротив, в IECs мы наблюдали только низкую экспрессию Ifnar1 и Ifnar2 (рис. 1A и S2). Анализ проточной цитометрии показал, что фракции IEC содержали около 5% клеток CD45 + (S1B фиг.).Таким образом, мы использовали флюоресцентную сортировку клеток для очистки эпителиальных (EpCAM + CD45 ) клеток от сырых фракций IEC и LPL (S1B фиг.). Анализ RT-qPCR выявил сильно сниженную экспрессию Ifnar1 и Ifnar2 в очищенных эпителиальных клетках по сравнению с лейкоцитами (EpCAM CD45 + ) (S1C фиг.).

    Рис. 1. Эпителиальные клетки кишечника минимально экспрессируют рецептор IFN-α / β и не реагируют на IFN I типа.

    (A) RT-qPCR анализ цепей рецепторов IFN-α / β ( Ifnar1, и Ifnar2 ) и цепей рецепторов IFN-λ ( Ifnlr1 и Il10r2 ) в эпителиальных клетках кишечника (IEC) и lamina propria лимфоциты (LPL), выделенные из цельной ткани кишечника взрослых мышей дикого типа (n = 4-8). (B) Экспрессия IFNAR1 проанализирована с помощью проточной цитометрии на фракциях IEC или LPL, собранных от мышей дикого типа или мышей Ifnar1 — / — . (C) RT-qPCR анализ двух репрезентативных ISG в устойчивом состоянии в IEC и LPL, выделенных от мышей дикого типа, Ifnar1 — / — и Ifnlr1 — / — мышей (n = 3 ). (D) Взрослым мышам Ifnar1 — / — и Ifnlr1 — / — дважды подкожно вводили 1 мкг IFN-λ2 мыши или IFN-αB / D человека соответственно в 24 года. ч и за 12 ч до умерщвления, как указано.IFN-индуцированный Mx1 в срезах тканей желудочно-кишечного тракта визуализировали с помощью иммунофлуоресценции. IFN-чувствительные клетки содержат ядерный Mx1 (точечные структуры зеленого цвета). Эпителиальные клетки экспрессируют E-кадгерин (красный). DAPI (синий) окрашивает ядра. Данные являются репрезентативными для двух-трех независимых экспериментов. Среднее ± SEM. Бар = 100 мкм. ns = несущественно, * p <0,05, ** p <0,01, *** p <0,001.

    https://doi.org/10.1371/journal.ppat.1004782.g001

    Чтобы определить, приведет ли низкая экспрессия Ifnar1 и Ifnar2 в IEC к низким уровням рецептора IFN-α на поверхности клетки, мы использовали IFNAR1-специфические антитела для экспериментов по иммуноокрашиванию.Анализ FACS подтвердил наличие легко определяемых уровней IFNAR1 на LPL мышей дикого типа, но не мышей Ifnar1 — / — (рис. 1B). Важно отметить, что в этих экспериментальных условиях окрашивание IEC от мышей дикого типа не было более интенсивным, чем окрашивание IEC от мышей Ifnar1 — / — (рис. 1B), демонстрируя, что экспрессия клеточной поверхности этого типа Рецептор I IFN в IEC изначально имеет низкий уровень. Эти данные предлагают простое объяснение того, почему IFN типа I неэффективен против вирусов в эпителиальных клетках кишечника.

    Мононуклеарные фагоциты от стерильных мышей с трудом вырабатывают ответы IFN типа I после запуска TLR или опосредованной вирусом иммунной стимуляции [24–26], что позволяет предположить, что сигналы, полученные от комменсальных бактерий, индуцируют исходную передачу сигналов IFN, которая калибрует порог активации различных клеток. типы и определяет, может ли хозяин вызвать своевременную воспалительную реакцию при встрече с патогеном. Мы предположили, что если IEC преимущественно реагировали на IFN-λ, IEC Ifnar1 — / — , но не Ifnlr1 — / — , мыши должны демонстрировать низкий устойчивый ответ IFN.Чтобы оценить эту гипотезу, мы измерили экспрессию двух репрезентативных ISG, Isg15 и Oasl2 , во фракциях IEC и LPL, выделенных из кишечной ткани дикого типа, Ifnar1 — / — и Ifnlr1 . — / — мышей (рис. 1С). Действительно, базовая экспрессия ISG была низкой в ​​IEC мышей Ifnlr1 — / — , но не Ifnar1 — / — . Как и ожидалось, обратный паттерн экспрессии ISG наблюдался в LPL, хотя эффект был менее выраженным.

    Для сравнительного анализа роли IFN типа I и IFN-λ в индукции экспрессии ISG в слизистой оболочке кишечника мы подкожно вводили высокую дозу рекомбинантного IFN и окрашивали ткани на IFN-индуцированный белок Mx1, который накапливается в ядрах IFN. -чувствительные клетки. Мышей с нокаутом рецептора IFN использовали для исключения фонового окрашивания Mx1, индуцированного эндогенным IFN. Инъекция IFN-λ мышам Ifnar1 — / — приводила к сильному накоплению Mx1 в ядрах E-кадгерин-положительных IEC желудочно-кишечного тракта на всей его длине (рис. 1D и S1D).Напротив, инъекция IFN-α мышам Ifnlr1 — / — приводила к сильному накоплению Mx1 в ядрах клеток собственной пластинки, но не в IEC (рис. 1D и S1D). Комбинированное лечение IFN-α и IFN-λ Ifnar1 — / — Ifnlr1 — / — контрольных мышей с двойным нокаутом не привело к обнаруживаемым уровням Mx1 в ядрах IEC или клетки области собственной пластинки (S1E фиг.).

    IFN типа I и IFN-λ играют избыточную роль в защите эпителия легких и верхних дыхательных путей от эпителиотропных респираторных вирусов [14,27]. В качестве положительного контроля для лечения in vivo IFN мы извлекали ткани дыхательных путей. Интересно, что иная картина возникла, когда образцы тканей дыхательных путей и кишечника одних и тех же животных были проанализированы на наличие Mx1. Подобно слизистой оболочке кишечника, IFN-λ индуцировал Mx1 исключительно в эпителиальных клетках респираторных тканей (S1F на фиг.).Однако у животных, получавших IFN-α, широкий спектр типов клеток из легких и трахеи, включая E-кадгерин-положительные эпителиальные клетки, показал заметное ядерное окрашивание Mx1 (фиг. S1F), что указывает на поразительные различия в чувствительности к IFN I типа. в клетках кишечника и дыхательных путей. Окрашивание Mx1 не наблюдалось в ткани дыхательных путей после комбинированной обработки IFN-α и IFN-λ Ifnar1 — / — Ifnlr1 — / — контрольных мышей с двойным нокаутом (S1G Рис. ).Эти результаты предполагают, что в отличие от эпителиальных клеток легких и трахеи, эпителиальные клетки кишечника полагаются почти исключительно на IFN-λ для противовирусной защиты.

    IEC являются мощными производителями IFN-λ

    Лимфоциты являются ключевыми продуцентами IFN типа I в слизистой оболочке кишечника [17,28]. Однако типы клеток кишечника, продуцирующие IFN-λ, не идентифицированы. Данные, представленные на рис. 1С, предполагают конститутивную продукцию исходных уровней IFN в кишечнике. Чтобы идентифицировать IFN-продуцирующие клетки в стабильном состоянии, мы отслеживали экспрессию генов IFN и IFN-λ типа I с помощью RT-qPCR в изолированных фракциях IEC и LPL от наивных взрослых мышей дикого типа.Существенная исходная экспрессия генов IFN типа I наблюдалась только в LPL, но не во фракции IEC (рис. 2A). Напротив, исходная экспрессия генов IFN-λ наблюдалась только во фракции IEC (рис. 2A). Анализ очищенных клеток показал, что продуцирующие IFN-λ клетки в эпителиальной фракции экспрессируют маркер CD45 (S3 фиг.). Следовательно, продуцирующие IFN-λ клетки слизистой оболочки кишечника в устойчивом состоянии имеют гематопоэтическое происхождение.

    Рис. 2. IEC являются мощными производителями IFN-λ, но не IFN типа I.

    (A) Базовая линия экспрессии генов Ifna5 , Ifnb и Ifnl2 / 3 в IEC и LPL, выделенных от взрослых мышей дикого типа (n = 3), по оценке с помощью RT-qPCR. (B) Взрослым мышам дикого типа (n = 3) внутрибрюшинно вводили 100 мкг polyI: C, и ткань кишечника собирали через 2 и 6 часов после обработки. Экспрессию Ifna5 , Ifnb и Ifnl2 / 3 анализировали с помощью RT-qPCR во фракциях IEC и LPL. (C) Анализ устойчивой экспрессии гена IFN-λ с помощью RT-qPCR в отсортированных по FACS клетках EpCAM + CD45 и EpCAM CD45 + из эпителиальной фракции.Данные являются репрезентативными для двух-трех независимых экспериментов. Среднее ± SEM. * р <0,05, ** р <0,01. Различными буквами над столбиками отмечены существенные различия (p <0,05).

    https://doi.org/10.1371/journal.ppat.1004782.g002

    Дендритные клетки являются основными продуцентами IFN после вирусной инфекции или стимуляции синтетическим аналогом двухцепочечной РНК poly I: C [29,30]. Действительно, внутрибрюшинная инъекция поли I: C мышам дикого типа запускала быструю экспрессию генов IFN типа I и типа III в клетках фракции LPL.Напротив, гены IFN Ifn12 / 3 , но не I типа, индуцировались в клетках фракции IEC в этих условиях (рис. 2B). Интересно, что клетки, сильно экспрессирующие IFN-λ в ответ на поли I: C в эпителиальной фракции, были не лейкоцитами, а в основном эпителиальными клетками EpCAM + (рис. 2C). В совокупности эти эксперименты идентифицировали IEC и часть иммунных клеток CD45 + слизистой оболочки как важные источники IFN-λ.

    IFN-λ ограничивает рост реовируса в эпителии кишечника и ограничивает выделение вируса с фекалиями

    В более ранних исследованиях мы использовали ротавирус для оценки роли IFN-λ в желудочно-кишечном тракте [23].Из-за высокого тропизма ротавирусов к IEC, опосредованное IFN противовирусное действие на другие типы клеток невозможно оценить с помощью ротавируса. Чтобы определить, почему система IFN разделена в слизистой оболочке кишечника, мы использовали реовирус в качестве модели [17,31–33]. Реовирусы млекопитающих обладают широким клеточным тропизмом и обладают низкой видовой специфичностью. После заражения пероральным путем передача сигналов IFN типа I имеет решающее значение для ограничения системного распространения реовируса. Напротив, у IFN-компетентных хозяев заболевание, вызванное реовирусом, в основном протекает в легкой форме [17,34,35].Действительно, внутрижелудочная инокуляция взрослых мышей Ifnar1 — / — штаммом реовируса человека 3 типа Dearing привела к тяжелым неврологическим симптомам, таким как паралич задних конечностей, и все Ifnar1 — / — животных нужно было умертвить на 4-й день после инфицирования. Напротив, никаких симптомов не наблюдалось после инфицирования взрослых мышей Ifnlr1 — / — и мышей дикого типа (S4A фиг.). Соответственно, репликация реовируса в терминальной ткани тонкой кишки на 4 день после инфицирования была значительно выше у мышей Ifnar1 — / — по сравнению с Ifnlr1 — / — или животными дикого типа (рис. 3A и S4B).

    Рис. 3. IFN-λ ограничивает репликацию реовируса в эпителии и определяет выделение вируса с фекалиями, тогда как IFN типа I блокирует репликацию в собственной пластинке и подавляет системное распространение.

    (AD) Взрослые мыши дикого типа (n = 25), Ifnar1 — / — (n = 18) и Ifnlr1 — / — (n = 27) мыши были инокулированы внутрижелудочно с 10 8 БОЕ реовируса T3D. Данные собраны из нескольких независимых экспериментов.(A) На 4-й день после инфицирования репликацию реовируса в ткани тонкой кишки анализировали титрованием вируса. (B) Титры реовируса в образцах фекалий, собранных у мышей дикого типа и мутантных мышей на 4-й день после инфицирования. (C, D) Иммуноокрашивание на антиген реовируса (зеленый), E-кадгерин (красный) и DAPI (синий) в (C) ткани тонкой кишки или (D) пятнах Пейера. Изображения представляют три независимых эксперимента. Бар = 100 мкм. ns = несущественно, ** p <0,01, *** p <0,001.

    https: // doi.org / 10.1371 / journal.ppat.1004782.g003

    Для эффективного распространения фекально-оральным путем кишечные вирусы должны выделяться из инфицированных тканей в просвет кишечника и выводиться с калом. На рис. 1 мы продемонстрировали, что IFN-λ, но не IFN типа I, вызывает сильный противовирусный ответ в эпителиальном барьере, который отделяет просвет кишечника от стерильных тканей хозяина. Чтобы изучить роль IFN типа I и типа III в экскреции вируса, мы количественно оценили выделение реовируса с фекалиями на 4-й день после инфицирования.Мы наблюдали высокие титры инфекционного вируса в кале взрослых мышей Ifnar1 — / — и Ifnlr1 — / — , но не мышей дикого типа (рис. 3B). Учитывая сильно различающиеся титры вируса в ткани кишечника (рис. 3A), мыши Ifnar1 — / — выделяли относительно небольшое количество вируса по сравнению с мышами Ifnlr1 — / — . Животные, лишенные обоих рецепторов IFN ( Ifnar1 — / — Ifnlr1 — / — ), имели титры вируса в тканях, сопоставимые с Ifnar1 — / — мышей, тогда как вирус выделялся. в кале было даже выше, чем у мышей Ifnlr1, , — / — (фиг. S4C).Вместе эти результаты предполагают, что выделенный вирус может происходить из разных типов клеток у мышей Ifnar1 — / — и Ifnlr1 — / — . Иммуногистохимическое окрашивание образцов тканей тонкой кишки подтвердило эту точку зрения. Антиген реовируса был почти исключительно обнаружен в IEC Ifnlr1 — / — мышей на 4 день после инфицирования (рис. 3C, правая панель), тогда как реовирус был ограничен клетками собственной пластинки в Ifnar1 — / — мышей (рис. 3C, средняя панель).Реовирус специфически прикрепляется к М-клеткам и первоначально реплицируется в клетках слизистой оболочки пейеровского пятна (PP) [36]. Соответственно, мы обнаружили антиген реовируса в клетках PP всех трех линий мышей (рис. 3D). У инфицированных мышей Ifnar1 — / — PP были увеличены, и наблюдались массивные изменения в структуре фолликул-ассоциированного эпителия (рис. 3D, средняя панель), как ранее описано для реовируса типа 1 [17]. У инфицированных мышей Ifnlr1 — / — таких изменений структуры ПП не отмечено.Интересно, что антиген реовируса в Ifnlr1 — / — был обнаружен в связанном с фолликулом эпителии, а также в подлежащей ткани (рис. 3D, правая панель). Напротив, окрашивание реовируса у животных дикого типа ограничивалось несколькими клетками РР, расположенными под эпителием (рис. 3D, левая панель). Эти данные показывают, что реовирус, продуцируемый IEC Ifnlr1 — / — мышей, может легче достигать фекалий, чем вирус, продуцируемый клетками в ткани ниже, — механизм, объясняющий наблюдаемое усиленное выделение вируса с фекалиями в Ifnlr1. — / — мышей.

    Реовирус реплицируется в эпителиальных клетках кишечника и желчевыводящих путей и вызывает смертельное заболевание печени у мышей-сосунков, лишенных функциональных рецепторов IFN-λ

    Тяжелый вирусный гастроэнтерит — серьезная проблема новорожденных и маленьких детей. Точно так же мыши-сосунки гораздо более восприимчивы к заболеваниям, вызванным рота- и реовирусами, чем взрослые животные [37–40]. В связи с этим мы спросили, может ли компартментарный паттерн ответа на IFN, уникальный для слизистой оболочки кишечника, иметь более выраженные последствия для молодых животных.Двухдневные животные дикого типа, Ifnlr1 — / — и Ifnar1 — / — животных были перорально инфицированы реовирусом, и титры вирусов в тонкой кишке и толстой кишке были проанализированы на 4-й день. постинфекция. В отличие от взрослых мышей, реовирус очень хорошо рос в кишечной ткани сосущих мышей Ifnlr1 — / — , а титры вируса в тонком кишечнике (рис. 4A) и толстой кишке (рис. S5A) таких животных. были значительно выше, чем у мышей Ifnar1 — / — .Иммуногистохимия выявила тяжелую инфекцию IEC в терминальной части тонкой кишки (рис. 4B) и толстой кишке (рис. S5B) мышей Ifnlr1 — / — , тогда как вирус в основном локализовался в области собственной пластинки тонкой кишки ( Рис. 4B) у мышей Ifnar1 — / — . Количественная оценка инфицированных вирусом клеток продемонстрировала поразительный дифференциальный клеточный тропизм реовируса к эпителиальным и неэпителиальным клеткам тонкого кишечника в зависимости от того, были ли рецепторы IFN-α или IFN-λ дефектными (S5C фиг.).Низкие уровни инфекционного реовируса были измерены в кишечной ткани мышей дикого типа (фиг. 4A), но вирусный антиген не был обнаружен с помощью иммуноокрашивания (фиг. 4B).

    Рис. 4. Реовирус широко реплицируется в эпителиальных клетках кишечника и желчных путей и вызывает смертельное заболевание печени у мышей-сосунков, лишенных функциональных рецепторов IFN-λ.

    Сосунки дикого типа (n = 7), Ifnar1 — / — (n = 8) и Ifnlr1 — / — (n = 11) мыши были инфицированы перорально 5 x 10 6 БОЕ реовируса T3D.Данные двух независимых экспериментов были объединены. (A) Титры реовируса в тонком кишечнике на 4-й день после инфицирования. (B) Иммуноокрашивание ткани тонкой кишки на 4-й день после инфицирования на антиген реовируса (зеленый), E-кадгерин (красный) и DAPI (синий). (C) Кинетика выживания мышей дикого типа (n = 11), Ifnar1 — / — (n = 13) и Ifnlr1 — / — (n = 15). (D) Иммуноокрашивание ткани печени, полученной на 4-й день после инфицирования. Антиген реовируса (зеленый), цитокератин (красный) и DAPI (синий).Стрелки указывают на внутрипеченочные желчные протоки. (E) Иммуноокрашивание внепеченочных желчных протоков на антиген реовируса (зеленый), цитокератин (красный) и DAPI (синий) на 4-й день после инфицирования. (F) Иммуноокрашивание на реовирусный антиген внепеченочного желчного протока больной мыши Ifnlr1 — / — на 8 день после инфицирования. Обратите внимание, что проток заполнен материалом, по-видимому, происходящим из инфицированных вирусом клеток. Бар = 100 мкм. ** p <0,01, *** p <0,001.

    https: // doi.org / 10.1371 / journal.ppat.1004782.g004

    В этих экспериментальных условиях у мышей Ifnar1 — / — развились неврологические симптомы и они скончались от реовирусной инфекции в течение 5-7 дней (рис. 4C). Ifnlr1 — / — мышей не проявляли ранних неврологических симптомов. Однако на 9-й день после инфицирования у них начали развиваться симптомы, типичные для синдрома жирных волос [40], сопровождающиеся прекращением набора веса. К 13 дню все инфицированные реовирусом Ifnlr1 — / — животных погибли или должны были быть умерщвлены из-за тяжелого заболевания (рис. 4С).Большинство щенков дикого типа, инфицированных реовирусом, показывали нормальную прибавку в весе до 11 дня, когда у некоторых животных начали развиваться неврологические симптомы, за которыми последовала внезапная потеря веса и смерть в течение следующих нескольких дней (рис. 4С).

    После перорального заражения мышей-сосунков реовирус типа 3 может распространяться на внутрипеченочный желчный эпителий (холангиоциты) и в мозг, вызывая заболевание печени или летальный энцефалит [40–43]. Чтобы определить, был ли синдром жирных волос, наблюдаемый у инфицированных мышей Ifnlr1 — / — , обусловлен преимущественной репликацией реовируса в билиарных эпителиальных клетках, мы окрашивали печень и внепеченочные желчные канальцы на вирусный антиген на 4-й день после лечения. -инфекционное заболевание.У этих животных действительно было обнаружено большое количество антигена реовируса во внепеченочных и внутрипеченочных цитокератин-положительных эпителиальных клетках желчных путей, но, по-видимому, не в любом другом типе клеток (рис. 4D и 4E). Напротив, реовирус-положительные клетки присутствовали по всей печени и обнаруживались рядом с эпителиальными клетками внепеченочных желчных протоков мышей Ifnar1 — / — , тогда как эпителий в основном не содержал вирусов (рис. 4D и 4E). Никаких вирусных антиген-положительных клеток не было ни в печени, ни в желчных протоках мышей дикого типа (рис. 4D и 4E).Анализ тканей мышей Ifnlr1 — / — , умерших от болезни, выявил разрушение желчного эпителия, накопление вирусного антигена и блокаду желчных протоков (рис. 4F). Окрашивание H&E ткани печени на 4-й день после инфицирования выявило воспалительные клетки у всех инфицированных реовирусом животных с инфильтратами, локализованными преимущественно вокруг внутрипеченочных желчных протоков у мышей Ifnlr1 — / — (фиг. S5D). Взятые вместе, эти исследования инфекций продемонстрировали четкое функциональное разделение IFN типа I и системы IFN-λ в противовирусной защите слизистой оболочки желудочно-кишечного тракта.Они также обнаружили, что реовирус может специфически нацеливаться на холангиоциты мышей Ifnlr1 — / — , которые заметно экспрессируют функциональные рецепторы IFN-λ [44].

    Своевременная продукция IFN-λ эпителиальными клетками способствует быстрому избавлению от кишечной реовирусной инфекции

    Чтобы более подробно охарактеризовать систему IFN слизистой оболочки, мы проанализировали репликацию реовируса в ткани кишечника мышей-сосунков на 1-й и 4-й день после инфицирования. В день 1 высокий уровень реовируса был обнаружен как у мышей дикого типа, так и у мутантных мышей титрованием и RT-qPCR.Вирус был в значительной степени очищен у мышей дикого типа к 4-му дню, но все еще присутствовал в кишечнике мышей Ifnar1 — / — и Ifnlr1 — / — (фиг. 5A и S6A). Анализ RT-qPCR РНК, выделенной из цельной ткани кишечника, выявил сильную экспрессию IFN-регулируемых генов Isg15 и Oasl2 у мышей дикого типа и Ifnar1 — / — мышей в день 1 (рис. 5B). ). Напротив, мыши Ifnlr1 — / — не смогли получить надлежащий ответ IFN на 1-й день и показали сильно ослабленный ответ на 4-й день после инфицирования (фиг. 5B).Аналогичная картина возникла при анализе изолированных фракций IEC, а не целых тканей (S6B фиг.), Что указывает на то, что защитный ответ в кишечнике преимущественно опосредуется IFN-λ, который вырабатывается быстро после вирусной инфекции.

    Рис. 5. Своевременная продукция IFN-λ эпителиальными клетками способствует быстрому избавлению от кишечной реовирусной инфекции.

    Сосунки дикого типа, Ifnar1 — / — и Ifnlr1 — / — мышей (n = 3–4) были перорально инфицированы 5 x 10 6 БОЕ реовируса T3D , и ткань собирали либо на 1-й, либо на 4-й день после инфицирования.(А) Кинетика репликации реовируса титрованием. (B) Экспрессия IFN-чувствительных генов Isg15 и Oasl2 в цельной ткани кишечника, проанализированная с помощью RT-qPCR. (C) Экспрессия генов Ifna5, , Ifnb, и Ifnl2 / 3 во фракции IEC мышей дикого типа и мышей Ifnlr1 — / — , оцененная с помощью RT-qPCR на 1 день после инфицирования . (D) Иммуноокрашивание ткани тонкого кишечника на антиген реовируса (красный), Mx1 (зеленый) и DAPI (синий).Пунктирной линией обозначена граница ворсинок. Бар = 50 мкм. d.p.i. = дни после заражения. Показаны репрезентативные данные для двух отдельных экспериментов. Среднее ± SEM. Различными буквами над столбиками отмечены существенные различия (p <0,05). * р <0,05.

    https://doi.org/10.1371/journal.ppat.1004782.g005

    Чтобы визуализировать вирус-индуцированный ответ IFN в слизистой оболочке кишечника во времени и пространстве, мы иммуноокрашивали срезы тканей инфицированных мышей-сосунков на антиген реовируса и Mx1 на Через 1 и 4 дня после заражения.На 1-й день большое количество вирус-положительных IEC было обнаружено в терминальной части тонкой кишки дикого типа, Ifnar1 — / — и Ifnlr1 — / — мышей ( Рис 5D). Высокие уровни ядерного Mx1 были обнаружены в большинстве IEC в образцах тканей от животных дикого типа и Ifnar1 — / — животных уже на 1 день после инфицирования. Напротив, сигналы Mx1 не были обнаружены в ткани мышей Ifnlr1 — / — в этот момент времени (рис. 5D, правые панели), что подтверждает, что ранние ответы обусловлены IFN-λ в эпителии.На раннем этапе после инфицирования клетки собственной пластинки, которые легко реагируют на экзогенный IFN типа I (см. Рис.1), не содержали детектируемых уровней Mx1 в организме дикого типа или Ifnlr1 — / — , что позволяет предположить, что этот тип I продукция IFN была низкой. К 4 дню после инфицирования животные дикого типа в значительной степени избавились от вируса, тогда как ткань кишечника мышей Ifnar1 — / — и Ifnlr1 — / — все еще была сильно положительной на реовирус. антиген.Интересно, что на 4-й день после инфицирования подавляющее большинство инфицированных клеток у мышей Ifnar1 — / — располагалось в области собственной пластинки, а не в эпителии, как на 1-й день, тогда как вирусный антиген оставался связанным с IECs в Ifnlr1 — / — мышей (рис. 5D, правые панели). Клиренс вируса из IEC дикого типа и мышей Ifnar1 — / — к 4-му дню коррелировал с сильным антивирусным состоянием, индуцированным IFN-λ, которое визуализировалось по сильному эпителиальному окрашиванию Mx1.Однако у мышей Ifnlr1 — / — только небольшая часть ворсинок была положительной на Mx1 в этот поздний момент времени, что указывает на то, что IFN-λ-независимые противовирусные ответы были индуцированы только в небольшой части IEC. день 4 (рис. 5D). Эти данные вместе с анализом экспрессии ISG с помощью RT-qPCR (фиг. 5B) демонстрируют, что во время кишечной вирусной инфекции IFN типа I не может компенсировать потерю IFN-λ, что приводит к длительной репликации вируса в эпителиальных клетках.

    Минимальная экспрессия Mx1 была обнаружена в клетках области собственной пластинки. Тем не менее, эти клетки оставались защищенными от реовируса у мышей дикого типа и мышей Ifnlr1 — / — , что позволяет предположить, что продукция IFN типа I во время реовирусной инфекции была низкой, но защитной (фиг. 5D). IFN типа I, который ограничивает системное распространение реовируса и защищает мышей от летальной инфекции, продуцируется дендритными клетками [17]. Продукция IFN-λ в инфицированном вирусом кишечнике до настоящего времени не анализировалась.Более ранние наблюдения показали, что клетки, происходящие из эпителия кишечника, являются мощными продуцентами IFN-λ (см. Рис. 2). Поэтому мы непосредственно измерили экспрессию генов IFN с помощью RT-qPCR во фракциях IEC, выделенных от мышей, инфицированных ложным вирусом и реовирусом. Ifn12 / 3 Гены IFN , но не I типа, значительно индуцировались в клетках мышей дикого типа на 1-й день после инфицирования (фиг. 5C). В препаратах IEC от мышей Ifnlr1 — / — , которые очень чувствительны к реовирусной инфекции, индукция генов Ifnl2 / 3 была почти в 100 раз выше, чем у инфицированных мышей дикого типа, тогда как IFN типа I. гены не экспрессировались с повышенной скоростью в этот ранний момент времени (рис. 5C).Наши данные демонстрируют, что IFN-λ, продуцируемый клетками эпителия кишечника, вызывает ранний противовирусный ответ, который в значительной степени очищает вирус от эпителиальных клеток к 4-му дню. IFN типа I, по-видимому, не играет важной роли на этой ранней стадии реовирусной инфекции. Это скорее предотвращает системное распространение вируса.

    Обсуждение

    Главный вывод из описанных здесь экспериментов состоит в том, что слизистая оболочка кишечника обладает высоко компартментализированной системой IFN, которая действует согласованно, ограничивая репликацию кишечного вируса, и что эпителий кишечника представляет собой уникальный клеточный компартмент в организме, который не сильно влияет на репликацию кишечного вируса. полагаются на IFN-α / β для противовирусной защиты, а скорее используют IFN-λ.Мы обнаружили, что IFN-α / β не может индуцировать экспрессию противовирусных генов в кишечном эпителии и не может защитить эти клетки от инфекции кишечным вирусом из-за низкой экспрессии рецепторного комплекса IFN-α / β. Напротив, IFN-λ индуцировал надежную противовирусную защиту в IEC. Гены IFN-λ, но не IFN-α / β, экспрессировались на низких, но определяемых уровнях в слизистой оболочке кишечника неинфицированных животных, а эпителий кишечника продуцировал высокие количества IFN-λ, но не IFN-α / β в ответ на лечение мышей. с химическим веществом, индуцирующим ИФН, или после реовирусной инфекции.Таким образом, эпителий кишечника и собственная пластинка кишечника представляют собой два отдела кишечника, которые не только преимущественно продуцируют, но и предпочтительно реагируют на различные типы IFN.

    Мыши, лишенные функционального рецептора IFN-α / β, проявляют высокую чувствительность к большому количеству вирусов, включая некоторые аттенуированные штаммы вирусов, которые не могут вызывать заболевание у животных дикого типа [2,4,14]. Интересно, однако, что ротавирусы, которые преимущественно инфицируют эпителий кишечника, лишь умеренно ограничиваются передачей сигналов через рецептор IFN типа I [18,21,23], открытие, которое можно легко объяснить описанным в этом отчете наблюдением, что IEC экспрессируют Рецептор IFN-α / β только на очень низком уровне.Аналогичным образом, репликация норовируса в кишечнике ограничивается IFN-λ, тогда как IFN типа I контролирует репликацию норовируса во внекишечных участках [45].

    Недавние экспериментальные данные указывают на роль IFN-λ в контроле вируса на различных эпителиальных поверхностях, кроме кишечника [15,44]. Однако, похоже, что вклад IFN-λ в эти другие участки, включая легкие, в основном уступает вкладу IFN типа I. Представленные здесь данные о реовирусе объясняют наши более ранние наблюдения с ротавирусом мышей, которые указали на неизбыточную роль IFN-λ в эпителиальных клетках кишечного тракта [23].Поскольку реовирус может активно реплицироваться в эпителии мышей с дефицитом рецептора IFN-λ, он имеет легкий доступ к просвету кишечника и в больших количествах выделяется с калом. Сравнительно низкое фекальное выделение реовируса, наблюдаемое у мышей с дефицитом рецептора IFN-α / β, можно объяснить барьерной функцией эпителиального слоя, в значительной степени не содержащего вирусов, который физически отделяет продуцирующие вирус клетки собственной пластинки от просвета кишечника.

    Ранее мы сообщали о значительной роли IFN-λ в выделении ротавируса из фекалий взрослых мышей [23].Мы также сообщили, что респираторный SARS-CoV может быть обнаружен в кале мышей, лишенных обеих рецепторных систем IFN, но не у мышей, у которых отсутствуют рецепторы только для IFN-α / β [14]. Соответственно, недавно было показано, что гены Stat1 и Ifnlr1 , но не гены Ifnar1 ограничивают выделение фекальных норовирусов у мышей [45]. В совокупности эти результаты указывают на существенную важность IFN-λ в ограничении экскреции вируса. Мы предполагаем, что другие цитокины, такие как IFN-γ, также могут вносить свой вклад, но здесь это не исследовалось.Поскольку фекально-оральный путь является основным путем передачи кишечных вирусов человека, таких как полиовирус, норовирус, ротавирус, вирусы гепатита Е и А, есть соблазн предположить, что IFN-λ помогает ограничить выведение этих важных патогенов человека.

    Плазмацитоидные дендритные клетки являются очень мощными продуцентами биологически активных IFN-α / β и IFN-λ [17,46,47], но большинство других типов клеток также способны экспрессировать гены IFN при вирусной инфекции. Несколько недавних исследований показали, что клетки эпителиального происхождения, такие как респираторный эпителий, кератиноциты и гепатоциты, являются мощными продуцентами IFN-λ у инфицированных вирусом хозяев [48–55].Мы обнаружили, что и IEC, и гематопоэтические клетки в эпителии сильно экспрессировали гены IFN-λ, но не IFN-α / β, быстро после стимуляции поли (I: C) и в ответ на реовирусную инфекцию. Таким образом, эпителий слизистой оболочки выработал механизмы, специфически продуцирующие IFN-λ. Поскольку считается, что аналогичные сигнальные пути контролируют экспрессию генов IFN-α / β и IFN-λ [56], это наблюдение является неожиданным и предполагает, что индукция генов, кодирующих IFN-α и IFN-β, специфически блокируется в IEC за счет неизвестный механизм.В поляризованных клетках кишечного эпителия связанные с пероксисомами MAVS могут преимущественно запускать экспрессию генов IFN-λ [57], предлагая потенциальное объяснение нашим наблюдениям.

    Реовирус, вводимый перорально, обладает широким тканевым тропизмом у мышей с дефицитом рецептора IFN-α / β, заражая гепатоциты, миокардиоциты и многие другие клетки, что в конечном итоге вызывает смертельное заболевание [17,34]. Мы обнаружили, что сосущие мыши, у которых отсутствуют функциональные рецепторы для IFN-λ, проявляют более легкое заболевание, чем мыши с дефицитом рецепторов IFN-α / β, хотя титры вирусов в желудочно-кишечном тракте животных с дефицитом рецепторов IFN-λ были значительно выше.Вероятно, это можно объяснить тем, что тяжелое повреждение эпителия кишечника не имеет немедленных летальных последствий. Интересно, что инфицированные реовирусом мыши-сосунки с дефицитом функциональных рецепторов к IFN-λ проявляли симптомы, напоминающие атрезию желчных путей [58], которые включали синдром жирной шерсти и воспаление печени. Атрезия желчевыводящих путей — редкое заболевание, которым страдает один из 10 000 младенцев, этиология и патология которого в значительной степени неизвестны. Было высказано предположение, что инфицирование различными вирусами, включая реовирус типа 3, связано с этим заболеванием у детей [59,60].Заражение мышей некоторыми штаммами рота- и реовирусов может воспроизводить большинство признаков болезни человека [61,62]. Мы обнаружили вирусный антиген в холангиоцитах наших мышей с дефицитом рецептора IFN-λ, но не мышей дикого типа или IFN-α / β-дефицитных мышей, которые были инфицированы реовирусом в раннем возрасте, что убедительно свидетельствует о том, что IFN-λ играет решающую роль в защите желчевыводящие пути против вирусов. Этот вывод согласуется с нашим недавним открытием, что холангиоциты мышей легко реагируют на экзогенный IFN-λ [44].Основываясь на результатах нашей модельной системы мышей, можно предположить, что дети с атрезией желчных путей могут иметь генетический дефект в их системе IFN-λ.

    Учитывая тот факт, что большинство типов клеток в организме защищены IFN-α / β, наш вывод о том, что IFN типа I играет незначительную роль в эпителии кишечника, является интригующим. В этом контексте важно отметить, что IFN-α / β — палка о двух концах. Помимо индукции и регулирования врожденного и приобретенного иммунитета против патогенов и опухолей, IFN-α / β также может вызывать чрезмерное воспаление (см. Обзор [63]) [64].Хронические вирусные инфекции, такие как ВИЧ или LCMV, могут приводить к дисфункции лимфоцитов из-за продолжительной передачи сигналов IFN [20,65] или устойчивости к стимуляции IFN в гепатоцитах в случае HCV [66]. Таким образом, возникает соблазн предположить, что эпителий кишечника, который находится в постоянном контакте с комменсальными бактериями, утратил способность продуцировать и реагировать на IFN-α / β из-за его потенциальных негативных эффектов.

    Материалы и методы

    Заявление об этике

    Все мыши, использованные в исследовании, были выращены на местном уровне в нашем учреждении и обработаны в соответствии с руководящими принципами Федерации ассоциаций лабораторных животных (www.felasa.eu/recommendations) и национальной организации по защите животных (Gesellschaft für Versuchstierkunde; www.gv-solas.de/index.html). Эксперименты на животных проводились в соответствии с немецким законом о защите животных (TierSchG) и одобрены местным комитетом по защите животных Университета Фрайбурга (разрешение G-12/93).

    Мыши

    Используемые линии мышей были описаны ранее [16]. Вкратце, мыши B6.A2G- Mx1 дикого типа несут интактные аллели Mx1 (дикого типа), B6.A2G- Mx1-Ifnar1 — / — у мышей отсутствуют функциональные рецепторы IFN-α / β ( Ifnar1 — / — ), B6.A2G- Mx1-Ifnlr1 — / У мышей отсутствуют функциональные рецепторы IFN-λ ( Ifnlr1 — / — ), а у мышей B6.A2G- Mx1-Ifnar1 — / — Ifnlr1 9 — / — двойной -нокаутные мыши ( Ifnar1 — / — Ifnlr1 — / — ) не имеют функциональных рецепторов как для IFN-α / β, так и для IFN-λ.Для экспериментов использовали новорожденных мышей массой 1,5–2 г или молодых взрослых мышей (в возрасте 6–8 недель).

    Клетки и вирус

    Штамм Dearing реовируса типа 3 размножали на линии клеток фибробластов мыши L929, поддерживаемой в среде DMEM с добавлением 10% FCS. Новорожденным мышам перорально инокулировали 5 мкл супернатанта клеточной культуры, содержащего 5 × 10 6 БОЕ вируса. Взрослым мышам внутрижелудочно вводили 100 мкл вируса (что соответствует 10 8 БОЕ) с использованием иглы для введения желудочного зонда 22G.Титры вирусов в фекалиях и гомогенатах тканей определяли с помощью анализа бляшек на клетках L929. Вкратце, ткань гомогенизировали в 800 мкл PBS и кал в 500 мкл PBS с использованием аппарата FastPrep (MP Biomedicals). Гомогенаты обрабатывали хлороформом (конечная концентрация 10%), недолго центрифугировали и серийные разведения водных супернатантов инкубировали на клетках L929 при комнатной температуре. Через 1 ч инокулят удаляли и клетки покрывали 1,5% AVICEL в 1x среде DMEM, содержащей 0.1% BSA. Через четыре дня среду удаляли, клетки фиксировали 4% параформальдегидом и бляшки визуализировали 0,5% кристаллическим фиолетовым.

    Лечение in vivo

    Один мкг гибридного человеческого IFN-αB / D [67] или мышиного IFN-λ2 (IL-28A; PeproTech) вводили подкожно в 100 мкл PBS. 100 мкг поли I: C вводили внутрибрюшинно в 200 мкл PBS.

    Иммуногистохимия

    Ткань фиксировали в 4% параформальдегиде при 4 ° C в течение 24 часов и заливали парафином.Поиск антигена на депарафинизированных срезах ткани размером 5 мкм на предметных стеклах проводили в 0,01 М натрий-цитратном буфере при 121 ° C в течение 10 мин. Ткань была проницаема в 0,05% Triton-X100 и заблокирована 10% нормальной ослиной сывороткой (Jackson ImmunoResearch) в течение 1 часа при комнатной температуре. Срезы инкубировали в течение ночи при 4 ° C с кроличьей антисывороткой против реовируса T3D (щедрый подарок Т. Дермоди, Университет Вандербильта), мышиным моноклональным антителом M149 против Mx1 [68], кроличьей поликлональной антисывороткой против Mx1 (AP5). [40] или мышиный моноклональный антипан-цитокератин (Sigma), за которым следует соответствующее вторичное антитело, конъюгированное с AF555, AF488, Cy3 или Cy5 (Molecular Probes, Jackson ImmunoResearch).E-кадгерин окрашивали моноклональным мышиным антителом против E-кадгерина, конъюгированным с AF647 (BD Bioscience Pharmingen). Слайды помещали в DAPI-содержащий Vectashield (Vector Laboratories).

    Количественное определение реовирус-положительных клеток в инфицированных тканях

    Срезы тканей окрашивали на антиген реовируса и одновременно на E-кадгерин для идентификации эпителиальных клеток. Количество реовирус-положительных клеток, экспрессирующих или лишенных E-кадгерина, оценивалось путем оценки антиген-реактивных клеток вируса в 3-х полях зрения срезов кишечника, полученных по меньшей мере из 3 отдельных Ifnar1 — / — и Ifnlr1 — / — мышей.

    Выделение лейкоцитов IEC и LP

    Выделение эпителиальных клеток кишечника и лейкоцитов собственной пластинки выполняли, как описано ранее [69]. Вкратце, весь тонкий кишечник собирали, разрезали в продольном направлении и ненадолго промывали PBS. Диссоциацию эпителиальных клеток проводили инкубацией при 37 ° C в HBSS, содержащем 5 мМ EDTA и 10 мМ Hepes, на шейкере в течение 20 мин. Оставшуюся ткань разрезали на кусочки размером приблизительно 1 мм. 2 перед ферментативным расщеплением 5 ед / мл диспазы (BD), 0.5 мг / мл коллагеназы D (Roche) и 0,5 мг / мл ДНКазыA (Sigma-Aldrich). Обогащение лимфоцитов проводили центрифугированием в градиенте Percoll (Sigma-Aldrich). Чистота выделенных фракций IEC и LPL была подтверждена путем анализа экспрессии маркерных генов эпителиального ( Cdh2 -кодирующего E-кадгерина) и лейкоцитарного ( Ptprc -кодирующего CD45) маркерных генов.

    Проточная цитометрия и сортировка клеток

    Одноклеточные суспензии лимфоцитов собственной пластинки анализировали с использованием проточного цитометра FACS Canto II и программного обеспечения FACS Diva (BD Biosciences).Для анализа данных использовалось программное обеспечение FlowJo V9.2 (TreeStar). Для анализа экспрессии на клеточной поверхности цепи рецептора 1 IFN α / β использовали PE-меченное моноклональное антитело MAR1-5A3 (eBioscience).

    Для сортировки кишечных эпителиальных клеток и лимфоцитов тонкий кишечник разрезали на кусочки размером 1 мм 2 и подвергали ферментативному расщеплению, как описано выше. После блокирования рецепторов Fc антителами к CD16 / CD32 одноклеточные суспензии инкубировали с флуоресцентными конъюгированными антителами против CD45 и EpCAM.После промывки клетки инкубировали с 4 ‘, 6-диамидино-2-фенилиндолом (DAPI) для исключения мертвых клеток и сортировали с использованием сортировщика клеток BD FACSAria III (BD Biosciences).

    Экстракция РНК и ОТ-КПЦР

    РНК

    выделяли с помощью реагента Trizol (Invitrogen) в соответствии с инструкциями производителя. Один мкг РНК подвергали обратной транскрипции с использованием набора для обратной транскрипции QuantiTect (Qiagen). ПЦР в реальном времени выполняли с использованием набора QuantiTect SYBR Green PCR Kit (Qiagen) или TaqMan Universal Master Mix с геноспецифическими зондами (Applied Biosystems) и запускали на детекторе последовательности ABIPrism 7900 (Applied Biosystems).Образцы были нормализованы по экспрессии Hprt. Были использованы следующие анализы TaqMan, специфичные для мышей: Hprt: Mm00446968_m1, Ifnl2 / 3: Mm04204156_gH, Ifna5: Mm00833976_s1 (Life Technologies). Для анализов на основе SYBR Green были использованы следующие праймеры: Ifnb: прямой, 5′- TCAGAATGAGTGGTGGTTGC -3 ‘, обратный, 5′- GACCTTTCAAATGCAGTAGATTC -3′, Isg15: прямой, 5′- GAGCTAGAGCCTGCAGCAAT -3’- ‘, обратный, 5’- TTCTGGGCAATCTGCTTCTT -3; Oasl2: вперед, 5’-GGATGCCTGGGAGAGAATCG -3 ’, обратный, 5’-TCGCCTGCTCTTCGAAACTG -3’; Ifnlr1: вперед 5’- GGAACTGAAGTACCAGGTGGA -3 ’, обратный 5’- GCCATAGGGAGTGTCAGGAA -3’; Il10rb: вперед, 5’-TCTCTTCCACAGCACCTGAA -3 ’, обратный, 5’-GAACACCTCGCCCTCCTC -3’; Ifnar1: вперед, 5’- CATGTGTGCTTCCCACCACT -3 ’, обратный, 5’- TGGAATAGTTGCCCGAGTCC -3’; Ifnar2: вперед, 5’- GACCTTCGGATAGCTGGTGG -3 ’, обратный, 5’- CTCATGATGTAGCCGTCCCC -3’; Ptprc: вперед, 5’-GAACTAAAACACATCTGGGAAAAATTA-3 ’, обратный, 5’-GCTTTCATGGTTGTTTTCACC-3’; Cdh2: вперед, 5’-CAGGTCTCCTCATGGCTTTGC-3 ’, обратный, 5’-CTTCCGAAAAGAAGGCTGTCC-3’.

    Статистический анализ

    Тестирование на статистическую значимость проводили для логарифмически трансформированных вирусных титров с помощью непарного t-критерия Стьюдента или однофакторного дисперсионного анализа и теста множественного сравнения Бонферрони с использованием программного обеспечения Prism 4 (программное обеспечение GraphPad).

    Дополнительная информация

    S1 Рис. Эпителиальные клетки желудочно-кишечного тракта не реагируют на IFN I типа.

    (A) Анализ RT-qPCR эпителиального маркерного гена Cdh2 (E-кадгерин) и лейкоцитарного маркерного гена Ptprc (CD45) во фракциях IEC и LPL.Данные являются репрезентативными для всех экспериментов по выделению клеток, описанных в тексте. (B) Стратегия гейтинга для эпителиальных клеток EpCAM + и лимфоидных клеток CD45 + , используемых во всех экспериментах FACS. (C) Гены рецептора IFN анализировали с помощью RT-qPCR в FACS-очищенных лимфоидных клетках CD45 + и эпителиальных клетках EpCAM + из фракций IEC или LPL, как указано. (DG) Взрослый Ifnar1 — / — , Ifnlr1 — / — и Ifnar1 — / — Ifnlr1 63 — / m лечили дважды 900 подкожно с 1 мкг IFN-λ2 мыши и / или IFN-αB / D человека за 24 и 12 ч до умерщвления, как указано (n = 2).IFN-индуцированный Mx1 в тканевых срезах визуализировали с помощью иммунофлуоресценции. IFN-чувствительные клетки содержат ядерный Mx1 (точечные структуры зеленого цвета). (E) Отсутствие IFN-индуцированной экспрессии Mx1 в срезах тканей желудочно-кишечного тракта или (G) дыхательных путей Ifnar1 — / — Ifnlr1 — / — мышей с двойным нокаутом одновременно обработанные IFN-λ2 и человеческим IFN-αB / D. (F) Срезы респираторной ткани животных, показанных на (D и фиг. 1D), анализировали на экспрессию Mx1.Данные являются репрезентативными для нескольких независимых экспериментов. Бар = 100 мкм. Среднее ± SEM. * p <0,05, ** p <0,01, *** p <0,001.

    https://doi.org/10.1371/journal.ppat.1004782.s001

    (TIFF)

    S2 Рис. Анализ рецепторов IFN в различных фракциях ткани тонкого кишечника.

    Экспрессия гена рецептора

    IFN проанализирована с помощью RT-qPCR в цельной ткани кишечника или изолированной фракции IEC, фракции LPL или остатке (строме) (n = 3-5). Буквы над столбиками обозначают значимые значения (p <0.05). Среднее ± SEM.

    https://doi.org/10.1371/journal.ppat.1004782.s002

    (TIFF)

    S3 Рис. Кроветворные клетки во фракции IEC продуцируют IFN-λ в стабильном состоянии.

    CD45 + лимфоидные клетки и эпителиальные клетки EpCAM + были очищены от фракций IEC и LPL до того, как экспрессия гена IFN была проанализирована с помощью RT-qPCR (n = 3-5). Среднее ± SEM. * p <0,05, ** p <0,01, *** p <0,001.

    https://doi.org/10.1371/journal.ppat.1004782.s003

    (TIFF)

    S4 Рис. Болезнь и репликация реовируса в кишечнике в основном контролируются IFN типа I у взрослых мышей.

    Взрослые мыши дикого типа, Ifnar1 — / — и Ifnlr1 — / — мыши были инфицированы внутрижелудочно 10 8 БОЕ реовируса T3D. (A) Кинетика выживания взрослых мышей дикого типа (n = 6), Ifnar1 — / — (n = 5) и Ifnlr1 — / — (n = 13).Данные были объединены из двух независимых экспериментов. d.p.i. = дни после заражения. (B) На 4-й день после инфицирования репликацию реовируса в терминальной ткани тонкой кишки анализировали с помощью RT-qPCR (n = 7–9). (C) Взрослым мышам дикого типа или мышам, лишенным функциональных рецепторов IFN, внутрижелудочно вводили 10 8 БОЕ реовируса T3D. На 4-й день после инфицирования репликацию реовируса в ткани тонкой кишки и выделение с фекалиями анализировали титрованием вируса. Показаны данные, полученные в результате нескольких независимых экспериментов.ns = незначимо, ** p <0,01, *** p <0,001

    https://doi.org/10.1371/journal.ppat.1004782.s004

    (TIFF)

    S5 Рис. IFN-λ ограничивает репликацию реовируса и защищает от воспаления печени у мышей-сосунков.

    Сосунки дикого типа (n = 7), Ifnar1 — / — (n = 8) и Ifnlr1 — / — (n = 11) мыши были инфицированы перорально 5 x 10 6 БОЕ реовируса T3D. Данные собраны из нескольких независимых экспериментов.(A) Титры реовируса в толстой кишке на 4-й день после инфицирования. (B) Иммуноокрашивание ткани толстой кишки на 4 день после инфицирования на антиген реовируса (зеленый), E-кадгерин (красный) и DAPI (синий). (C) Количественная оценка инфицированных реовирусом клеток в E-кадгерин-положительных (E-cad + ) и отрицательных (E-cad ) клетках из Ifnlr1 — / — и Ifnar1 — / — мышей. (D) H&E окрашивание ткани печени. Изображения представляют несколько независимых экспериментов.Бар = 100 мкм. Среднее ± SEM. * p <0,05, *** p <0,001.

    https://doi.org/10.1371/journal.ppat.1004782.s005

    (TIFF)

    S6 Рис. Ответы эпителиальных клеток на реовирусную инфекцию зависят от передачи сигналов рецептора IFN-λ.

    Сосунки дикого типа, Ifnar1 — / — и Ifnlr1 — / — мышей (n = 3–4) были перорально инфицированы 5 x 10 6 БОЕ реовируса T3D , и эпителиальные клетки выделяли либо на 1-й, либо на 4-й день после инфицирования.(A) Кинетика репликации реовируса с помощью RT-qPCR. (B) Экспрессия IFN-чувствительных генов Isg15 и Oasl2 проанализирована с помощью RT-qPCR. Буквы над столбиками обозначают значимые значения (p <0,05). Среднее ± SEM. d.p.i. = дни после заражения.

    https://doi.org/10.1371/journal.ppat.1004782.s006

    (TIFF)

    Благодарности

    Мы благодарим Теренса Дермоди (Университет Вандербильта, Нэшвилл, Теннесси) за предоставление антисыворотки, специфичной для реовируса, и Томаса Михильса и Отто Халлера за полезные обсуждения.

    Вклад авторов

    Задумал и спроектировал эксперименты: TM PH AD PS. Проведены эксперименты: ТМ PH KG. Проанализированы данные: TM PH AD PS. Внесенные реактивы / материалы / инструменты анализа: TM PH AD PS. Написал статью: TM PH PS.

    Ссылки

    1. 1. Randall RE, Goodbourn S (2008) Интерфероны и вирусы: взаимодействие между индукцией, сигнализацией, противовирусными реакциями и мерами противодействия вирусам. J Gen Virol 89: 1–47. pmid: 18089727
    2. 2.Haller O, Kochs G, Weber F (2006) Схема ответа интерферона: индукция и подавление патогенными вирусами. Вирусология 344: 119–130. pmid: 16364743
    3. 3. van den Broek MF, Muller U, Huang S, Zinkernagel RM, Aguet M (1995) Иммунная защита у мышей, лишенных рецепторов интерферона типа I и / или типа II. Immunol Rev 148: 5–18. pmid: 8825279
    4. 4. Muller U, Steinhoff U, Reis LF, Hemmi S, Pavlovic J, et al. (1994) Функциональная роль интерферонов типа I и типа II в противовирусной защите.Наука 264: 1918–1921. pmid: 8009221
    5. 5. Krause CD, Pestka S (2005) Эволюция цитокинов и рецепторов класса 2 и открытие новых друзей и родственников. Pharmacol Ther 106: 299–346. pmid: 156
    6. 6. Теофилопулос А.Н., Баккала Р., Бейтлер Б., Коно Д.Х. (2005) Интерфероны типа I (альфа / бета) в иммунитете и аутоиммунитете. Анну Рев Иммунол 23: 307–336. pmid: 15771573
    7. 7. Schindler C, Levy DE, Decker T (2007) Передача сигналов JAK-STAT: от интерферонов до цитокинов.J Biol Chem 282: 20059–20063. pmid: 17502367
    8. 8. Старк Г.Р., Дарнелл Дж. Э. мл. (2012) Путь JAK-STAT в двадцать. Иммунитет 36: 503–514. pmid: 22520844
    9. 9. Кларк CJ, Трапани JA, Johnstone RW (2001) Механизмы опосредованной интерфероном противовирусной устойчивости. Препарат Curr нацелен на нарушение метаболизма иммунных эндокринных клеток 1: 117–130. pmid: 12476793
    10. 10. Schoggins JW, Wilson SJ, Panis M, Murphy MY, Jones CT и др. (2011) Различные генные продукты являются эффекторами противовирусного ответа интерферона типа I.Природа 472: 481–485. pmid: 21478870
    11. 11. Котенко С.В., Галлахер Г., Баурин В.В., Льюис-Антес А., Шен М. и др. (2003) IFN-lambdas опосредуют противовирусную защиту через отдельный рецепторный комплекс цитокинов класса II. Нат Иммунол 4: 69–77. pmid: 12483210
    12. 12. Шеппард П., Киндсфогель В., Сюй В., Хендерсон К., Шлюцмайер С. и др. (2003) IL-28, IL-29 и их рецептор цитокинов класса II IL-28R. Нат Иммунол 4: 63–68. pmid: 12469119
    13. 13. Sommereyns C, Paul S, Staeheli P, Michiels T (2008) IFN-lambda (IFN-lambda) экспрессируется тканезависимым образом и в первую очередь действует на эпителиальные клетки in vivo.PLoS Pathog 4: e1000017. pmid: 18369468
    14. 14. Mordstein M, Neugebauer E, Ditt V, Jessen B, Rieger T, et al. (2010) Лямбда-интерферон делает эпителиальные клетки дыхательных путей и желудочно-кишечного тракта устойчивыми к вирусным инфекциям. J Virol 84: 5670–5677. pmid: 20335250
    15. 15. Mordstein M, Michiels T, Staeheli P (2010) Что мы узнали от мышей с нокаутом рецептора IL28? J Интерферон цитокин Res 30: 579–584. pmid: 20649452
    16. 16.Mordstein M, Kochs G, Dumoutier L, Renauld JC, Paludan SR, et al. (2008) Интерферон-лямбда способствует врожденному иммунитету мышей против вируса гриппа А, но не против гепатотропных вирусов. PLoS Pathog 4: e1000151. pmid: 18787692
    17. 17. Johansson C, Wetzel JD, He J, Mikacenic C, Dermody TS и др. (2007) Интерфероны типа I, продуцируемые кроветворными клетками, защищают мышей от летального заражения реовирусом млекопитающих. J Exp Med 204: 1349–1358. pmid: 17502662
    18. 18.Angel J, Franco MA, Greenberg HB, Bass D (1999) Отсутствие роли интерферонов типа I и типа II в разрешении вызванной ротавирусом диареи и инфекции у мышей. J Интерферон цитокин Res 19: 655–659. pmid: 10433367
    19. 19. Holloway G, Coulson BS (2013) Врожденные клеточные ответы на ротавирусную инфекцию. J Gen Virol 94: 1151–1160. pmid: 23486667
    20. 20. Тейджаро Дж. Р., Нг Си, Ли А.М., Салливан Б.М., Шихан К.С. и др. (2013) Персистирующая инфекция LCMV контролируется блокадой передачи сигналов интерферона I типа.Science 340: 207–211. pmid: 23580529
    21. 21. Фен Н, Ким Б., Фено М., Нгуен Х., Во П и др. (2008) Роль интерферона в гомологичной и гетерологичной ротавирусной инфекции в кишечнике и внекишечных органах мышей-сосунков. J Virol 82: 7578–7590. pmid: 18495762
    22. 22. Ока С., Игараси Х., Нагата Н., Сакаи М., Коике С. и др. (2007) Создание системы оральной инфекции полиовируса у трансгенных мышей, экспрессирующих рецептор полиовируса человека, у которых отсутствует рецептор альфа / бета интерферона.J Virol 81: 7902–7912. pmid: 17507470
    23. 23. Pott J, Mahlakoiv T, Mordstein M, Duerr CU, Michiels T, et al. (2011) IFN-лямбда определяет противовирусную защиту кишечного эпителия хозяина. Proc Natl Acad Sci U S A 108: 7944–7949. pmid: 21518880
    24. 24. Танигучи Т., Такаока А. (2001) Слабый сигнал для сильных ответов: пересмотр интерферона-альфа / бета. Nat Rev Mol Cell Biol 2: 378–386. pmid: 11331912
    25. 25. Ganal SC, Sanos SL, Kallfass C, Oberle K, Johner C и др.(2012) Примирование естественных клеток-киллеров неслизистыми мононуклеарными фагоцитами требует инструктивных сигналов от комменсальной микробиоты. Иммунитет 37: 171–186. pmid: 22749822
    26. 26. Abt MC, Osborne LC, Монтичелли Л.А., Деринг Т.А., Аленгхат Т. и др. (2012) Комменсальные бактерии калибруют порог активации врожденного противовирусного иммунитета. Иммунитет 37: 158–170. pmid: 22705104
    27. 27. Crotta S, Davidson S, Mahlakoiv T, Desmet CJ, Buckwalter MR, et al. (2013) Интерфероны типа I и типа III управляют избыточными петлями амплификации, чтобы индуцировать сигнатуру транскрипции в инфицированном гриппом эпителии дыхательных путей.PLoS Pathog 9: e1003773. pmid: 24278020
    28. 28. Сен А., Ротенберг М.Э., Мукерджи Г., Фенг Н., Калиски Т. и др. (2012) Врожденный иммунный ответ на гомологичную ротавирусную инфекцию в ворсинчатом эпителии тонкого кишечника при одноклеточном разрешении. Proc Natl Acad Sci U S A 109: 20667–20672. pmid: 23188796
    29. 29. Каваи Т., Акира С. (2006) Врожденное иммунное распознавание вирусной инфекции. Nat Immunol 7: 131–137. pmid: 16424890
    30. 30. Colonna M, Krug A, Cella M (2002) Клетки, продуцирующие интерферон: на передовой в иммунных ответах против патогенов.Curr Opin Immunol 14: 373–379. pmid: 11973137
    31. 31. Fulton JR, Cuff CF (2004) Слизистая и системный иммунитет к кишечной реовирусной инфекции у старых мышей. Опыт Геронтол 39: 1285–1294. pmid: 15489051
    32. 32. Чен Д., Рубин Д.Х. (2001) Т-клеточный ответ слизистой оболочки на реовирус. Immunol Res 23: 229–234. pmid: 11444387
    33. 33. Major AS, Rubin DH, Cuff CF (1998) Иммунитет слизистой оболочки к реовирусной инфекции. Curr Top Microbiol Immunol 233: 163–177. pmid: 9599937
    34. 34.Dionne KR, Galvin JM, Schittone SA, Clarke P, Tyler KL (2011) Передача сигналов интерферона типа I ограничивает реовирусный тропизм в головном мозге и предотвращает летальную системную инфекцию. J Neurovirol 17: 314–326. pmid: 21671121
    35. 35. Rubin DH, Eaton MA, Anderson AO (1986) Реовирусная инфекция у взрослых мышей: гемагглютинин вируса определяет место кишечного заболевания. Microb Pathog 1: 79–87. pmid: 2854595
    36. 36. Amerongen HM, Wilson GA, Fields BN, Neutra MR (1994) Протеолитический процессинг реовируса необходим для прикрепления к кишечным М-клеткам.J Virol 68: 8428–8432. pmid: 7525989
    37. 37. Потт Дж., Стокингер С., Торов Н., Смочек А., Линднер С. и др. (2012) Зависимая от возраста экспрессия TLR3 кишечного эпителия способствует чувствительности к ротавирусу. PLoS Pathog 8: e1002670. pmid: 22570612
    38. 38. Арнольд MM, Сен A, Гринберг HB, Паттон JT (2013) Битва между ротавирусом и его хозяином за контроль пути передачи сигналов интерферона. PLoS Pathog 9: e1003064. pmid: 23359266
    39. 39.Манн М.А., Книпе Д.М., Фишбах Г.Д., Филдс Б.Н. (2002) Нейроинвазия реовируса типа 3 после внутримышечной инокуляции: прямая инвазия нервных окончаний и возраст-зависимый патогенез. Вирусология 303: 222–231. pmid: 124

    40. 40. Бартон Е.С., Юри Б.Е., Эберт Д.Х., Форрест Дж. К., Коннолли Дж. Л. и др. (2003) Использование сиаловой кислоты в качестве корецептора необходимо при реовирусной болезни желчевыводящих путей. Дж. Клин Инвест 111: 1823–1833. pmid: 12813018
    41. 41. Derrien M, Hooper JW, Fields BN (2003) Сегмент гена M2 участвует в способности реовируса типа 3Abney вызывать синдром жирной шерсти у новорожденных мышей, фенотип, связанный с сегментом гена S1.Вирусология 305: 25–30. pmid: 12504537
    42. 42. Wilson GA, Morrison LA, Fields BN (1994) Ассоциация гена реовируса S1 с серотипом 3-индуцированной атрезией желчных путей у мышей. J Virol 68: 6458–6465. pmid: 8083983
    43. 43. Тайлер К.Л., Лезер Дж.С., Фанг Т.Л., Кларк П. (2010) Экспрессия генов в головном мозге во время реовирусного энцефалита. J Neurovirol 16: 56–71. pmid: 20158406
    44. 44. Hermant P, Michiels T (2014) Интерферон-лямбда в контексте вирусных инфекций: продукция, ответ и терапевтические последствия.J. Врожденный иммунитет 6: 563–574. pmid: 24751921
    45. 45. Nice TJ, Baldridge MT, McCune BT, Norman JM, Lazear HM и др. (2014) Интерферон-лямбда излечивает стойкую норовирусную инфекцию у мышей при отсутствии адаптивного иммунитета. Наука.
    46. 46. Коча Е.М., Севера М., Джакомини Э., Моннерон Д., Ремоли М.Э. и др. (2004) Вирусная инфекция и агонисты Toll-подобных рецепторов индуцируют дифференциальную экспрессию интерферонов типа I и лямбда в человеческих плазматических и дендритных клетках, происходящих из моноцитов.Eur J Immunol 34: 796–805. pmid: 149
    47. 47. Анк Н., Иверсен МБ, Бартольди С., Стахели П., Хартманн Р. и др. (2008) Важная роль интерферона III типа (IFN-lambda / IL-28) в TLR-индуцированной противовирусной активности. J Immunol 180: 2474–2485. pmid: 18250457
    48. 48. Ioannidis I, Ye F, McNally B, Willette M, Flano E (2013) Экспрессия толл-подобных рецепторов и индукция интерферонов типа I и типа III в эпителиальных клетках первичных дыхательных путей. J Virol 87: 3261–3270.pmid: 23302870
    49. 49. Ван Дж., Оберли-Диган Р., Ван С., Никрад М., Фанк С.Дж. и др. (2009) Дифференцированные человеческие альвеолярные клетки типа II секретируют противовирусный IL-29 (IFN-lambda 1) в ответ на инфекцию гриппа А. J Immunol 182: 1296–1304. pmid: 175
    50. 50. Джуэлл Н.А., Клайн Т., Мерц С.Е., Смирнов С.В., Флано Э. и др. (2010) Лямбда-интерферон является преобладающим интерфероном, индуцируемым вирусом гриппа A in vivo. J Virol 84: 11515–11522. pmid: 20739515
    51. 51.Хаитов MR, Laza-Stanca V, Edwards MR, Walton RP, Rohde G и др. (2009) Индукция респираторным вирусом альфа-, бета- и лямбда-интерферонов в эпителиальных клетках бронхов и мононуклеарных клетках периферической крови. Аллергия 64: 375–386. pmid: 1

      99
    52. 52. Окабаяси Т., Кодзима Т., Масаки Т., Йокота С., Имаидзуми Т. и др. (2011) Интерферон III типа, а не I типа, является преобладающим интерфероном, индуцируемым респираторными вирусами в эпителиальных клетках носа. Virus Res 160: 360–366.pmid: 21816185
    53. 53. Зан С., Рекампер С., Куммерер Б.М., Ферринг-Шмидт С., Бибер Т. и др. (2011) Доказательства патофизиологической роли интерферона III типа (IFNlambda), происходящего из кератиноцитов, при кожной красной волчанке. J Invest Dermatol 131: 133–140. pmid: 20720564
    54. 54. Марукиан С., Андрус Л., Шихан Т.П., Джонс С.Т., Чарльз ЭД и др. (2011) Вирус гепатита С индуцирует интерферон-лямбда и интерферон-стимулированные гены в первичных культурах печени.Гепатология 54: 1913–1923. pmid: 21800339
    55. 55. Томас Э., Гонсалес В.Д., Ли К., Моди А.А., Чен В. и др. (2012) Инфекция ВГС вызывает уникальный врожденный иммунный ответ печени, связанный с устойчивой выработкой интерферонов типа III. Гастроэнтерология 142: 978–988. pmid: 22248663
    56. 56. Оногути К., Йонеяма М., Такемура А., Акира С., Танигучи Т. и др. (2007) Вирусные инфекции активируют гены интерферона I и III типов посредством общего механизма. J Biol Chem 282: 7576–7581.pmid: 17204473
    57. 57. Odendall C, Dixit E, Stavru F, Bierne H, Franz KM, et al. (2014) Различные внутриклеточные патогены активируют экспрессию интерферона III типа из пероксисом. Нат Иммунол 15: 717-726. pmid: 24952503
    58. 58. de Carvalho E, Ivantes CA, Bezerra JA (2007) Внепеченочная билиарная атрезия: современные концепции и будущие направления. J Pediatr (Rio J) 83: 105–120. pmid: 17426869
    59. 59. Morecki R, Glaser JH, Cho S, Balistreri WF, Horwitz MS (1982) Билиарная атрезия и реовирусная инфекция типа 3.N Engl J Med 307: 481–484. pmid: 6285193
    60. 60. Тайлер К.Л., Сокол Р.Дж., Оберхаус С.М., Ле М, Каррер Ф.М. и др. (1998) Обнаружение РНК реовируса в гепатобилиарных тканях у пациентов с атрезией внепеченочных желчных путей и кистами холедоха. Гепатология 27: 1475–1482. pmid: 9620316
    61. 61. Phillips PA, Keast D, Papadimitriou JM, Walters MN, Stanley NF (1969) Хроническая механическая желтуха, индуцированная реовирусом типа 3 у мышей-отъемышей. Патология 1: 193–203. pmid: 4330558
    62. 62.Riepenhoff-Talty M, Schaekel K, Clark HF, Mueller W., Uhnoo I, et al. (1993) Ротавирусы группы А вызывают обструкцию внепеченочных желчевыводящих путей у новорожденных мышей, которым перорально привили. Pediatr Res 33: 394–399. pmid: 8386833
    63. 63. Trinchieri G (2010) Интерферон I типа: друг или враг? J Exp Med 207: 2053–2063. pmid: 20837696
    64. 64. Davidson S, Crotta S, McCabe TM, Wack A (2014) Патогенный потенциал интерферона алфавита при острой гриппозной инфекции. Нац Коммуна 5: 3864.pmid: 24844667
    65. 65. Boasso A, Hardy AW, Anderson SA, Dolan MJ, Shearer GM (2008) ВИЧ-индуцированный катаболизм интерферона I типа и триптофана приводят к дисфункции Т-клеток, несмотря на фенотипическую активацию. PLoS One 3: e2961. pmid: 18698365
    66. 66. Makowska Z, Duong FH, Trincucci G, Tough DF, Heim MH (2011) На передачу сигналов интерферона-бета и интерферон-лямбда не влияет индуцированная интерфероном рефрактерность к интерферону-альфа in vivo. Гепатология 53: 1154–1163. pmid: 21480323
    67. 67.Horisberger MA, de Staritzky K (1987) Гибрид рекомбинантного человеческого интерферона-альфа B / D с широким кругом хозяев. J Gen Virol 68 (Pt 3): 945–948.
    68. 68. Flohr F, Schneider-Schaulies S, Haller O, Kochs G (1999) Центральная интерактивная область человеческой MxA GTPase участвует в активации GTPase и взаимодействии с вирусными структурами-мишенями. FEBS Lett 463: 24–28. pmid: 10601631
    69. 69. Sanos SL, Diefenbach A (2010) Выделение NK-клеток и NK-подобных клеток из собственной пластинки кишечника.Методы Мол Биол 612: 505–517. pmid: 20033661
    Анализ

    u-plex IFN-α2a человека | Мезо весы Discovery

    MSD предлагает ряд индивидуальных анализов с использованием наборов антител U-PLEX, которые обеспечивают быстрый и удобный метод измерения биомаркеров в сложных матрицах.Индивидуальные анализы предлагаются на планшетах MSD GOLD со стрептавидином Small Spot и используют те же наборы антител и разбавители, что и мультиплексные анализы U-PLEX. Это обеспечивает эффективный перенос между индивидуальным анализом и мультиплексной конфигурацией с более высокой пропускной способностью. Типичные для анализов, разработанных на платформе MSD, отдельные анализы обладают высокой чувствительностью, превосходной точностью, обеспечивают до пяти логарифмов линейного динамического диапазона и требуют минимального объема образца. Интерфероны (IFN) представляют собой семейство цитокинов, которые производятся и секретируются клетками иммунной системы в ответ на вирусы, бактерии, паразиты, раковые клетки или другие чужеродные вещества, вторгающиеся в организм.IFN действуют как активатор ответа иммунной системы, уменьшая рост раковых клеток или уничтожая патогены. Существует 3 класса интерферонов (IFN-α, INF-β и IFN-γ) с различными, а также перекрывающимися эффектами. Все интерфероны являются противовирусными и противоопухолевыми средствами, но действуют на организм по-разному. IFN-α продуцируются макрофагами и используются в основном для лечения рака и вирусных инфекций. IFN-α2a — это одобренный FDA препарат для лечения волосатоклеточного лейкоза, связанной со СПИДом саркомы Капоши и хронического миелолейкоза.Анализ U-PLEX Human IFN-α2a предоставляет компоненты для количественного определения как природного, так и рекомбинантного человеческого IFN-α2a в сыворотке, плазме и супернатантах клеточных культур.

    • Характеристики
    • Комплект поставки
    • использованная литература
    • Документация
    Приложения) Цитокины и хемокины , Иммунология / Воспаление
    Аналит (ы) IFN-α2a
    Разновидность Человек
    Инструмент MESO QuickPlex SQ 120 , СЕКТОР Imager 2400 , СЕКТОР Imager 6000 , МЕЗО СЕКТОР S 600
    Совместимость U-PLEX Group Биомаркеры Группа 1, Метаболическая группа 1
    Тип плиты 96-луночный
    Захват антител Мышь моноклональная
    Обнаружение антител Мышь моноклональная
    LLOD (чувствительность) 4.0 пг / мл
    Динамический диапазон 4-42 400 пг / мл
    Тип образца Сыворотка, плазма, супернатант клеточной культуры
    Рекомбинантные стандарты Выражено в E.кишечная палочка
    Заявление об использовании Только для исследовательского использования. Не использовать в диагностических процедурах.
    Заявление (-а) о хранении Пожалуйста, обратитесь к вкладышу продукта для получения информации об условиях хранения отдельных компонентов набора.
    Условия хранения Многокомпонентный
    Заголовок Журнал Год
    IgG к SARS-CoV-2 от тяжелобольных пациентов с COVID-19 способствует гипервоспалительным ответам макрофагов
    Виллианн Хопель, Хунг-Джен Чен, Сона Аллахвердиева, Сюэ Манц, Юрджан Аман, Амстердам UMC COVID-19 Biobank, Питер Бонта, Филип Брауэр, Стивен де Тэе, Том Каниелс, Карлин ван дер Стратен, Корнелиуш Голебски, Гильермо Гриффит , Мэдс Ларсен, Федерика Линти, Аннетт Нил, Ян Ноута, Франк ван Барле, Корнелис ван Друнен, Александр Влаар, Годельев де Бри, Роджер Сандерс, Лиза Виллемсен, Манфред Вухрер, ​​Харм Ян Богард, Марит ван Гилс, Гестур Видарссон, Менно де Винтер, Йерун ден Даннен
    TBD 2020 г.
    Надежность самостоятельного отбора проб для точной оценки вирусной и иммунологической кинетики респираторных вирусов
    Альпана Вагмаре, Элизабет М. Кранц, Субхасиш Барал, Эмма Васкес, Тилли Лоффельхольц, Э.Лиза Чанг, Урваши Пандей, Джейн Кайперс, Элизабет Р. Дюк, Кейт Р. Джером, Александр Л. Греннингер, Дэниел Б. Ривз, Флориан Хладик, И. Фабиан Кардозо-Охеда, Майкл Бек, Джошуа Т. Шиффер
    TBD 2020 г.
    Эндогенные внутрипеченочные ИФН и связь с исходом лечения ВГС без ИФН.
    Meissner EG, Wu D, Osinusi A, Bon D, Virtaneva K, Sturdevant D, Porcella S, Wang H, Herrmann E, McHutchison J, Suffredini AF, Polis M, Hewitt S, Prokunina-Olsson L, Masur H, Fauci AS, Коттилил С.
    J Clin Invest 2014 г.
    Контактная информация
    Обслуживание клиентов / Заказы
    1-240-314-2795

    5:00 а.м. до 20:00
    Восточное время США


    Эл. адрес

    Научно-техническая поддержка
    1-240-314-2798

    с 5:30 до 17:30
    Восточное время США


    Эл. адрес

    Инструментальная опора
    1-301-947-2057

    8:30 — 17:30
    Восточное время США


    Эл. адрес

    Головной офис компании
    1-240-314-2600
    1601 Research Blvd.
    Роквилл, Мэриленд 20850-3173
    США

    Набор V-PLEX NHP IFN-γ | Мезо весы Discovery

    Заголовок Журнал Год
    Галектин-9, участник синдрома высвобождения цитокинов и суррогатный диагностический биомаркер при инфекции SARS-CoV-2
    Наджме Бозоргмехр, Сиаваш Машхури, Элиана Перес Росеро, Лай Сюй, Шима Шахбаз, Венди Слигл, Мохаммед Осман, Деметриос Дж.Куцогианнис, Эрика Макинтайр, Конар Р. О’Нил, Шокроллах Элахи
    мБио 2021 г.
    IgG к SARS-CoV-2 от тяжелобольных пациентов с COVID-19 способствует гипервоспалительным ответам макрофагов
    Виллианн Хопель, Хунг-Джен Чен, Сона Аллахвердиева, Сюэ Манц, Юрджан Аман, Амстердам UMC COVID-19 Biobank, Питер Бонта, Филип Брауэр, Стивен де Тэе, Том Каниелс, Карлин ван дер Стратен, Корнелиуш Голебски, Гильермо Гриффит , Мэдс Ларсен, Федерика Линти, Аннетт Нил, Ян Ноута, Франк ван Барле, Корнелис ван Друнен, Александр Влаар, Годельев де Бри, Роджер Сандерс, Лиза Виллемсен, Манфред Вухрер, ​​Харм Ян Богард, Марит ван Гилс, Гестур Видарссон, Менно де Винтер, Йерун ден Даннен
    TBD 2020 г.
    Мультисистемный воспалительный синдром у детей и COVID-19 — разные проявления SARS – CoV-2.
    Кэролайн Диорио, Сара Э.Хенриксон, Лаура А. Велла, Кевин О. МакНерни, Джули Чейз, Чаккапонг Барудпакди, Джессика Х. Ли, Кристина Джасен, Фрэн Баламут, Дэвид М. Барретт, Бренда Л. Бэнвелл, Кэтрин М. Бернт, Эллисон М. Блатц, Кэтлин Чиотос, Брайан Т. Фишер, Джули К. Фицджеральд, Джеффри С. Гербер, Кэндис Голломп, Кристофер Грей, Стефан А. Групп, Ребекка М. Харрис, Тодд Дж. Килбо, Одри Р. Одом Джон, Мишель Ламберт, Эмили Дж. Либлинг, Мишель Э. Песслер, Уитни Петроса, Чарльз Филлипс, Энн Ф. Рейли, Нил Д.Ромберг, Аликс Сейф, Дебора А. Сесок-Пиццини, Кэтлин Е. Салливан, Джули Вардаро, Эдвард М. Беренс, Дэвид Т. Тичи, Хамид Бассири
    Журнал клинических исследований 2020 г.
    Надежность самостоятельного отбора проб для точной оценки вирусной и иммунологической кинетики респираторных вирусов
    Альпана Вагмаре, Элизабет М. Кранц, Субхасиш Барал, Эмма Васкес, Тилли Лоффельхольц, Э.Лиза Чанг, Урваши Пандей, Джейн Кайперс, Элизабет Р. Дюк, Кейт Р. Джером, Александр Л. Греннингер, Дэниел Б. Ривз, Флориан Хладик, И. Фабиан Кардозо-Охеда, Майкл Бек, Джошуа Т. Шиффер
    TBD 2020 г.
    Ранние и поздние эффекты материнского опыта на нейрогенез гиппокампа, микроглию и среду циркулирующих цитокинов
    Рэнд С.Ид, Джессика А. Чайтон, Стефани Э. Либлих, Тамара С. Боднар, Джоан Вайнберг, Лийза А.М. Галеа
    Нейробиология старения 2019 г.
    Посмотреть все

    The India Fund, Inc.

    Дэн Бьюкенен: Добро пожаловать в последнюю серию подкастов о закрытых фондах Aberdeen Standard Investments, в которых мы встречаемся с нашими менеджерами закрытых портфелей и получаем некоторое представление об этих сложных рыночных условиях. Сегодня мы фокусируемся на индийских акциях вместе с управляющим индийского фонда Юджон О., «Доброе утро, Юджон» или «Добрый вечер в Сингапуре».

    Юджон: Доброе утро.

    Дэн Бьюкенен: Юджон, я подумал, что было бы хорошо начать с обновленной информации о пандемии в Индии и о том, чем она отличается от 2020 года.

    Юджон: Ага, ладно. Спасибо, Дэн. Так что, я думаю, все читали в новостях о том, что происходит в Индии, особенно за последние пару недель, поскольку мы действительно наблюдаем тревожную вторую волну COVID-19, захлестнувшую страну. Темп новых случаев заболевания в день более чем в три раза превышает пик, который мы наблюдали в 2020 году. И это действительно перегрузило систему здравоохранения и вынудило правительства штатов повторно ввести карантин по всей стране. Однако правительство ясно дало понять, что вторая общенациональная блокировка будет наименее предпочтительным вариантом.И они очень много работали, чтобы увеличить масштабы лечения и вакцинации. Например, мы видели, как Индия ускорила процесс утверждения вакцины в России. И они также получают медицинский кислород от производителей стали. Они делают все, что в их силах, чтобы противостоять скорости, с которой вторая волна прошла по стране. Он начался в Мумбаи и Дели, но мы видели, как он переместился в некоторые из более южных штатов, и мы ожидаем, что в ближайшие недели он переместится на восток.Так что на самом деле, это случай наблюдения, чтобы увидеть, сможет ли локализованная блокировка попытаться остановить распространение и заражение вирусом COVID-19, который, очевидно, ухудшит то, что мы наблюдаем с точки зрения инфляции, если мы увидим полную блокировку, которая опять же, это повлияет на цепочку поставок по всей стране.

    Помимо того факта, что это более сильное напряжение, которое мы наблюдаем в этом году, я думаю, что ключевые отличия от 2020 года, которые вы затронули в своем вопросе, на самом деле заключаются в том, что реакция на него была немного другой.Итак, у нас нет национальной изоляции, как я упоминал ранее, но на самом деле это создает некоторую неопределенность, потому что все государства могут решать ее по-своему. Таким образом, мы не совсем уверены, какие состояния будут заблокированы и на какой срок в любой момент времени. Однако одним из положительных моментов является то, что производству было разрешено оставаться открытым, а цепочки поставок уже скорректировались в 2020 году. Таким образом, мы видим, что многие производственные цепочки поставок могут продолжаться, несмотря на более недавнюю волну случаев COVID.И экспорт также держится, поддерживаясь мировой торговлей. Так что это должно означать, что показатели объема производства в Индии также останутся более устойчивыми в этом году.

    Я думаю, что некоторые из местных фактов заключаются в том, что на этот раз вирус больше затронул зажиточные семьи. Таким образом, мы видим потенциально больший удар по потребительским расходам, если эти зажиточные домохозяйства будут оставаться дома, а не выходить на улицу, тратить и поддерживать восстановление экономики. И мы также наблюдаем более широкое распространение в сельских районах, что, конечно же, снова ставит под сомнение прочность инфраструктуры здравоохранения Индии и насколько хорошо она проникает в более сельские регионы.

    Я думаю, что одна из вещей, которые схожи с точки зрения проблем с остальной частью мировой экономики, — это инфляция. Таким образом, мы наблюдаем инфляцию цен на сырьевые товары, которая также проникает в Индию. И это, очевидно, очень сложно в то время, когда многие компании уже сократили низкие расходы на структуру своих расходов еще в прошлом году, во время первой волны вирусов. Мы очень внимательно за этим следим, потому что сегодня, очевидно, очень сложно попытаться переложить эти инфляционные издержки на потребителей.Так что это действительно риски, которых мы как долгосрочные инвесторы в Индии остерегаемся.

    Дэн Бьюкенен: Спасибо, Юджон. И как рынки отреагировали на этот драматический второй всплеск на фоне, о котором вы только что говорили?

    Yoojeong: Да, на самом деле это было довольно удивительно, потому что индийский рынок был довольно устойчивым. А фондовый рынок с конца марта торговался в боковом тренде. На самом деле, пока что в мае у него есть небольшой пробег.Таким образом, он оказался очень устойчивым, несмотря на поток новостей и то, что мы слышали о вирусе. И основная причина этого заключалась в том, что продажи на внутреннем рынке компенсировали иностранным инвесторам, которые выводят свои деньги из Индии, потому что они становятся все более не склонными к риску, но внутренний инвестор, розничный инвестор в Индии, они возвращают свои деньги. на фондовый рынок, особенно на рынке со средней капитализацией. Таким образом, мы наблюдаем некоторую пену в оценках, в частности, в этом секторе малой и средней капитализации, о чем вы могли бы знать, и что действительно может представлять риски с точки зрения будущих доходов, учитывая, что рост прибыли будет подвергаться риску, в зависимости от того, что произойдет. с этой второй волной и как Индии удается с этим справляться.

    Дэн Бьюкенен: И Юджон, какое настроение у компаний и руководства, с которыми вы разговариваете в регионе?

    Юджон: Ага, значит, мы подошли к концу первого квартала в конце марта. И эти результаты начали появляться в апреле. В связи с этим компании начали встречаться с инвесторами, и на самом деле результаты за март на конец квартала во всех отношениях были довольно позитивными. Но первые три месяца года на самом деле не отражают вторую волну COVID, которая с тех пор поразила Индию.И поэтому мы действительно смотрим на перспективу. И я думаю, что большинство корпораций по-прежнему довольно осторожны с точки зрения прогнозов, которые они предоставляют, учитывая неопределенность, с которой они также сталкиваются.

    Но опять же, я думаю, что в каждом секторе очень важно различать компании с хорошим качеством и убедиться, что вы инвестируете в нужные компании с правильной бизнес-моделью, правильным балансом, правильной ценовой политикой. хорошо. Итак, вы знаете, если я посмотрю на что-то вроде банковского сектора, например, тогда, вы знаете, у них действительно были очень хорошие результаты за первый квартал.Но на самом деле у банков дела обстоят немного хуже, чем у остального рынка. И это действительно потому, что все обеспокоены тем, что новый всплеск случаев COVID может повлиять на кредитоспособность, качество и способность заемщиков своевременно возвращать ссуды. Таким образом, этот риск давит на банковский сектор. Но если вы посмотрите на авуары, которые у нас есть в индийском фонде, то мы выбрали высококачественные банки, у которых есть хорошая базовая бизнес-модель, где качество активов хорошее, и у них очень липкие клиентские депозиты из-за силы их розничные франшизы.Таким образом, руководство, с которым мы встречаемся, на самом деле не видит того стресса, о котором вы читаете, когда смотрите на всю финансовую систему. Поэтому я считаю, что нужно вкладывать деньги в правильные части каждого сектора.

    Другой ключевой сектор для Индии — ИТ-услуги. И опять же, компании, которые мы здесь держим, являются более качественными компаниями с широким ростом бизнеса, у нас есть несколько очень положительных результатов ESG в этом секторе, так как один из наших холдингов стал углеродно-нейтральным уже в этом году, а это 30 на годы раньше срока, установленного для снижения выбросов углерода.И вы можете себе представить, что ИТ-сервисные компании имеют очень энергоэффективные кампусы по всему миру. Так что они настоящие победители с точки зрения той экологической политики, которой они следуют. То же самое и со скрепками, вы можете представить, что это очень оборонительный сектор. Так что у нас были хорошие результаты от наших основных компаний. И они очень хорошо подготовились к тому, чтобы справиться с риском новых блокировок в будущем. Таким образом, компании, которыми мы владеем, скорректировали свои цепочки поставок уже в 2020 году. Так что мы не ожидаем снова больших сбоев с какими-либо новыми раундами изоляции.Увеличилась доля продаж, поступающих через Интернет, по отношению к вкладу электронной коммерции в их общий объем продаж. И они также привлекли к своим оптовым каналам все больше местных семейных и популярных магазинов. Мы очень поддерживаем местные предприятия и следим за тем, чтобы денежные потоки в некоторых из наиболее сельских районов Индии продолжали работать и функционировать, несмотря на то, о чем вы читаете в газете.

    Итак, я думаю, что в целом хорошие результаты во всех секторах, но на самом деле вам нужно выбрать, в какие акции вы хотите инвестировать.И я думаю, что что-то вроде того, что сейчас, когда перспективы настолько неопределенны, когда существует риск роста прибыли, тогда, имея знания, чтобы выбрать более качественные компании на рынке, которые вы можете купить и удерживать в течение длительного времени, я думаю, что это дает нам очень сильное преимущество при сборке акций снизу вверх.

    Дэн Бьюкенен: И это действительно подводит меня к следующему вопросу относительно IFN. Индийский фонд имеет структуру закрытого фонда, которая отличается от открытого паевого инвестиционного фонда или ETF.Мне любопытно, с точки зрения управляющего портфелем, как структура закрытого фонда помогает вам эффективно управлять портфелем?

    Юджон: Да, это было действительно полезно, особенно в то время, когда рынки настолько волатильны, поскольку нам не нужно так беспокоиться о потоках и ликвидности, потому что часто, когда инвесторы больше всего боятся, на самом деле самое время что мы хотим вкладывать больше денег в работу, потому что оценки привлекательны. И мы видим хорошие перспективы роста в долгосрочной перспективе, но, возможно, с краткосрочной волатильностью из-за этой неопределенной перспективы.Таким образом, мы не заставляем продавцов падать на рынке. И я думаю, что это одна из самых сильных сторон закрытой структуры фонда. И мы использовали это в наших интересах, чтобы быть очень стабильными инвесторами в компании, которые, как мы думаем, станут победителями через пять или десять лет, мы действительно не пытаемся играть в какие-либо краткосрочные дела, мы » Мы не пытаемся назвать результат того, когда закончится вторая волна или появятся ли новые пути в будущем. На самом деле речь идет о возможности убедить наши звонки и не беспокоиться о ежедневных потоках, и я думаю, что это большое преимущество того, чтобы быть закрытым фондом.

    Дэн Бьюкенен: И Юджон, изменили ли вы и ваша команда вообще портфель IFN в свете этой меняющейся среды, которую мы обсуждали?

    Юджон: Ага, так что оборот в фонде на самом деле довольно низкий. И мы, вы знаете, управляем им таким образом, чтобы не постоянно пытаться сбить портфель, это совсем не то, что вы ожидаете от качественного инвестора. Так что мы действительно просто придерживаемся своего процесса. И я не думаю, что в фонде произошли какие-то серьезные изменения.Но мы, очевидно, собираемся реагировать, когда видим возможности, когда рынок нестабилен и когда мы чувствуем, что оценки не отражают долгосрочный рост, рост прибыли и качество компании. Итак, мы вносили некоторые изменения в фонд, но наш оборот все еще ниже 25%. В этом смысле очень скромно, и я думаю, что если вы посмотрите на индийский рынок, то в этом году также будет довольно активный трубопровод IPO. Итак, опять же, это возможность купить в некоторых секторах, которые обычно очень высоки, где оценки очень дороги, но где мы можем попробовать купить их по более низкой оценке, просто учитывая неопределенность и общий страх, который испытывают рынки. работать в нашу пользу.Потому что, как вы знаете, мы являемся долгосрочными инвесторами, поэтому мы можем взглянуть на это в более долгосрочной перспективе.

    [Неформальный разговор]

    Дэн Бьюкенен: И, наконец, что бы вы сказали клиентам, чтобы они успокоились, что они должны инвестировать в индийские акции сегодня, Юджон?

    Юджон: Да, думаю, я уже говорил это пару раз раньше. Но я думаю, что в Индии мы действительно находим много привлекательных компаний. И я думаю, если мы примем точку зрения, что сегодня в Индии существует краткосрочный риск для роста доходов.Но мы смотрим на это в более долгосрочной перспективе. И мы думаем о демографии в Индии и поддержке роста внутреннего спроса на трехлетней, пятилетней или даже десятилетней основе, и у вас есть молодая и растущая потребительская база, растущий средний класс, у вас растущее образование. и растущая приверженность корпораций глобальным вопросам ESG. И я думаю, у вас есть очень хорошие охотничьи угодья, чтобы искать хорошо оцененные и качественные компании, которые будут работать в долгосрочной перспективе. Так что, если у вас есть место в распределении активов, и вы ищете стратегию роста, и помните, IFN также дает скидку по отношению к стоимости чистых активов.Так что я думаю, что это привлекательный способ играть на привлекательном рынке в долгосрочной перспективе.

    Дэн Бьюкенен: Что ж, это отличная информация. Спасибо, Юджон, за эти идеи сегодня и спасибо нашим слушателям за настройку. Вы можете узнать больше о фонде на www.aberdeenifn.com. Обращайте внимание на будущие серии.

    IFN типа I расположен в эндосомах

    Abstract

    IFN типа I (IFN-I), как полагают, быстро усваивается и разрушается после связывания с его рецептором и инициации передачи сигналов.Однако во многих исследованиях сообщается о стойких эффектах, опосредованных IFN-I в течение нескольких дней или даже недель, как ex vivo, так и in vivo. Эти длительные эффекты приписываются последующим сигнальным молекулам или индуцированным эффекторам, имеющим длительный период полужизни, особенно в определенных типах клеток. Здесь мы описываем механизм, объясняющий долгосрочные эффекты IFN-I. После связывания рецептора IFN-I распределяется по эндосомным компартментам. Эти внутриклеточные «силосы» IFN сохраняются в течение нескольких дней и могут быть визуализированы с помощью флуоресценции и электронной микроскопии.Однако функционально они в значительной степени неактивны из-за индуцированных IFN-I негативных регуляторов. Напротив, у людей, лишенных этих негативных регуляторов, таких как ISG15 или USP18, этот изолированный IFN-I может продолжать передавать сигналы изнутри эндосомы. Этот механизм может лежать в основе долгосрочных эффектов терапии IFN-I и может вносить вклад в патофизиологию интерферонопатий I типа.

    IFN типа I (IFN-I) представляет собой мощный противовирусный и воспалительный цитокин с относительно коротким периодом полувыведения (1).Исчезает из плазмы через несколько часов после внутримышечного введения (2). Даже пегилированный IFN-I имеет период полураспада всего 2 дня у человека (3). Тем не менее, IFN-I имеет долгосрочные функциональные эффекты. Например, экспрессия OAS1 , IFN-стимулированного гена (ISG), остается близкой к пиковым уровням в течение 1 недели у людей, получавших пегилированный IFN-I (4). Точно так же после заражения гриппом и разрешения у мышей лейкоциты костного мозга экспрессируют противовирусные гены и становятся устойчивыми к инфекции гриппа, несмотря на отсутствие определения IFN-I в костном мозге или сыворотке в иммуноферментном анализе (5).Аналогичным образом, люди, у которых отсутствуют ISG15 или USP18, оба ключевых негативных регулятора IFN-I, имеют высокие уровни ISG в мононуклеарных клетках периферической крови (PBMC), как и ожидалось, но циркулирующий IFN-I выявляется только у половины лиц с дефицитом ISG15 ( 6), подчеркивая эффективность IFN-I. Здесь мы исследуем клеточные механизмы, управляющие этим человеческим фенотипом.

    Результаты / Обсуждение

    Только половина пациентов с дефицитом ISG15 имеет определяемый циркулирующий IFN-I, но у всех наблюдается высокий уровень ISG в их PBMC (6), что характерно для всех интерферонопатий I типа (7).Мы исследовали этот феномен путем количественной оценки информационной РНК (мРНК) ISG после 12 часов примирования IFN-I и 36 часов отдыха в фибробластах, иммортализованных hTert. В конце этого 48-часового периода уровни мРНК ISG были значительно выше в ISG15- и USP18-дефицитных клетках, чем в контрольных клетках (рис. 1 A ). Эти высокие уровни мРНК ISG сохранялись до 5 дней после прайминга IFN-I (в основном, следовательно, в отсутствие цитокина) в ISG15-дефицитных клетках, но возвращались к значениям до прайминга в контрольных клетках через 24 часа (8).Учитывая сохранение ISG в течение нескольких дней после удаления IFN-I, мы исследовали, накапливаются ли ISG из-за отсутствия подавления регуляции во время первоначального воздействия IFN-I или из-за активной транскрипции после удаления цитокина. RT-qPCR на растущих транскриптах РНК, выделенных через 36-60 часов после удаления IFN-I, выявила активную транскрипцию ISG в ISG15- и USP18-дефицитных клетках, но не в контрольных клетках (рис. 1 B ). Таким образом, транскрипция происходит спустя долгое время после элиминации IFN-I в ISG15- и USP18-дефицитных клетках.

    Рис. 1.

    Постоянство передачи сигналов IFN-I в ISG15- и USP18-дефицитных клетках. ( A ) Контрольным фибробластам, фибробластам с дефицитом ISG15 или USP18 вводили 0,197 нМ (1000 ед / мл) IFNα2b в течение 12 часов, промывали и отдыхали в течение 36 часов во всех экспериментах. Относительные единицы мРНК MX1 определяли количественно с помощью qPCR. ( B ) После A добавляли EU на 24 часа, выделяли РНК, содержащую EU (возникающая РНК), и проводили кПЦР. ( C и D ) Вестерн-блоттинг или IF для фосфо-STAT1, фосфо-STAT2 и общего STAT2 согласно A .Ленточная денситометрия pSTAT1 относительно тубулина для C . (Увеличение в D : 40 ×.) ( E ) Клетки инкубировали с 10 мкМ Cerdulatinib (Cerd) или носителем (диметилсульфоксид [DMSO]) в течение 4 часов после A и проводили вестерн-блоттинг. ( F и G ) Клетки были примированы и оставлены присутствующими антителами, и был проведен ( F ) кПЦР или ( G ) вестерн-блоттинг. ( H ) КПЦР для мРНК IFNB после протокола первичного останова или полиинозиновая: полицитидиловая кислота (поли I: C).( I ) Клетки подвергали первичному отдыху согласно A , и супернатанты помещали на наивные контрольные клетки на 8 часов (NT) или с анти-IFNα. Контрольные клетки, которым вводили 0,197 нМ IFN-I (8 ч), служили положительным контролем, и количественно определяли мРНК RSAD2 . СЭМ представлены непарные тесты Стьюдента t : * P <0,05, ** P <0,01, *** P <0,001, **** P <0,0001. ns = не имеет значения.

    Мы исследовали молекулы, действующие дальше вверх по течению, и обнаружили pSTAT1 и pSTAT2 (медиаторы проксимальной передачи сигналов IFN-I) (9) в клетках с дефицитом ISG15 и USP18, но не в контрольных клетках (рис.1 C ), что соответствует инициации транскрипции. Иммунофлуоресцентное окрашивание (IF) для общего STAT2 в этот момент времени подтвердило его ядерную локализацию (фиг. 1 D ). В присутствии Cerdulatinib, ингибитора киназы Janus (JAK), pSTAT1 и pSTAT2 были отменены, что указывает на то, что JAK все еще были активны через 36 часов после удаления IFN-I (рис. 1 E ). Мы убедились, что ничтожно малое количество остаточного растворимого цитокина не вызывает эту позднюю транскрипцию, путем инкубации клеток с антителом против IFN-I (рис.1 F и G ) и подтвердили, что IFN-I не транскрибируется в клетках (фиг. 1 H ). Мы действительно обнаружили незначительные количества IFN-I в супернатанте, но он был полностью заблокирован антителом IFN-I (рис. 1 I ). Вместе эти результаты демонстрируют, что передача сигналов, опосредованная IFN-I, может происходить в отсутствие растворимого цитокина.

    Эти результаты предполагают либо то, что существует «бесситокиновая» передача сигналов, либо что цитокин присутствует в клетках. Мы проверили эти гипотезы, выполнив объемную флуоресцентную визуализацию после обработки флуоресцентно меченным IFN-I.Клетки HeLa стимулировали IFN-I в течение 17 часов, промывали, оставляли в покое в течение 25 часов, а затем отображали с помощью микроскопии решетчатых световых пластинок (LLSM). Мы обнаружили IFN-I, колокализованный с Rab5, ранним эндосомным маркером, демонстрируя, что IFN-I удерживался в том, что мы называем «силосами IFN» (рис. 2 A ), ранее недооцененными сайтами хранения IFN-I. Мы обнаружили эти бункеры во всех генетических фонах (рис. 2 B ). Хотя известно, что рецептор IFN-I (IFNAR) подвергается эндоцитозу (10), это документальное подтверждение того, что IFN-I присутствовал эндосомно после прекращения передачи сигнала.Мы демонстрируем, что IFNAR необходим для формирования активных силосов IFN-I (рис. 2 C ). Используя массив одиночных молекул (SiMoA) (фиг. 2 D ) и электронную микроскопию (EM), мы подтвердили внутриклеточное удерживание IFN-I (фиг. 2 E ). Наконец, в то время как ингибитор эндоцитоза минимально влияет на проксимальную передачу сигналов, он полностью меняет фенотип в клетках, лишенных негативной регуляции (Fig. 2 F ).

    Рис. 2.

    IFN-I удерживается внутриклеточно. ( A ) Клетки HeLa, экспрессирующие Rab5-mNeonGreen (зеленый), инкубировали с 5 нМ DY647 IFNα2 (пурпурный) в течение 17 часов, промывали, отдыхали в течение 25 часов и визуализировали с помощью LLSM ( Top ).Необработанные клетки демонстрируют фоновую автофлуоресценцию ( Нижний ). Z-выступы состоят из пяти секций (общая толщина 0,52 мкм). График в виде прямоугольников показывает коэффициенты корреляции для совместной локализации IFNα2 и Rab5 ( n = 10 клеток). ( B ) Контрольным, ISG15- и USP18-дефицитным клеткам давали DY647 IFNα2 в течение 17 часов и визуализировали или оставляли в покое в течение 24 часов и определяли количество везикул IFN-I. ( C ) ЭМ контрольных или IFNAR2-дефицитных клеток, которым вводили 0,5 нМ биотина IFN-I в течение 15 мин.Желтые стрелки обозначают положительную иммунореактивность. ( D ) Прайм-покоя клетки оценивали с помощью SiMoA, P = 0,0093. ( E ) ЭМ контрольных клеток, которым вводили 0,5 нМ биотина IFN-I в течение 12 часов, промывали и помещали в среду, содержащую 0,2 мкг / мл анти-IFNa или носитель (овечья сыворотка), в течение 36 часов. Типичный пример отрицательного контроля ( 1 ) без биотина IFN-I; ( 2 ) IFN-I биотин 12 ч, отдых 36 ч; ( 3 ) IFN-I биотин, 12 часов, анти-IFNα в течение 36 часов отдыха; и ( 4 ) IFN-I биотин, 12 часов, овечья сыворотка в течение 36 часов отдыха.Звездочкой обозначены немеченые эндосомы; стрелка обозначает положительную иммунореактивность внутри эндосомы; n = 50 ячеек на условие. ( F ) Клетки примировали-покоя в ДМСО или 100 мкМ PitStop2, и проводили qPCR. Клетки, которым вводили IFN-I с ДМСО или PitStop2 в течение 6 ч, служили контролем. СЭМ представлены непарные тесты Стьюдента t : * P <0,05, **** P <0,0001.

    Представленные здесь данные помогают разрешить парадокс длительных эффектов цитокина после того, как он больше не обнаруживается.Этот феномен объясняется удержанием IFN-I в эндосомах Rab5 + после передачи сигнала, при этом продолжение передачи сигналов в значительной степени предотвращается с помощью USP18 в клетках дикого типа. Таким образом, передача сигналов отменяется не устранением цитокина, а действием негативных регуляторов. Взаимосвязь между оборотом USP18 и скоростью деградации IFN-I в эндосоме может оставлять место для низких уровней передачи сигналов IFN-I в некоторых типах клеток, что потенциально объясняет долгосрочные эффекты терапии IFN-I in vivo. .Будет очень интересно определить, способствует ли удерживание в эндосомах IFN-I воспалению при заболеваниях, для которых характерны сигнатуры IFN-I, таких как системная красная волчанка (11), при которой цитокин не может быть легко обнаружен. но ISG есть.

    Материалы и методы

    Клетки представляли собой иммортализованные hTert дермальные фибробласты от контрольных пациентов, пациентов с дефицитом ISG15 и USP18. ОТ-КПЦР выполняли, как описано ранее (8). Для захвата зарождающейся РНК этинил уридин (EU) инкубировали в течение 24 часов.МРНК, содержащая EU, была выделена для RT-qPCR (12). Вестерн-блоттинг выполняли, как описано ранее (8). Для конфокальной микроскопии клетки окрашивали на DAPI и STAT2 (sc-476; 1: 100). Для анализа использовались микроскоп Leica SP5 DMI и Cell Profiler. Для блокирования IFN-I использовали антитело против IFNα человека (PBL 31110–1) в концентрации 0,2 мкг / мл с овечьей сывороткой (Millipore S3772, 1: 3 для эквивалентной концентрации) в качестве носителя. Сайт-специфическое мечение IFN выполняли, как описано ранее (13, 14).Для флуоресцентной микроскопии клетки трансфицировали фосфатом кальция с помощью pSEMS Rab5 mNeonGreen (pSEMS-26m Covalys) и обрабатывали DY647 IFNα2 в течение 17 часов, промывали и оставляли в покое в течение 25 часов. Визуализация живых клеток была выполнена с помощью LLSM (15). Для EM клетки стимулировали 0,5 нМ биотинилированного IFN-I в течение 15 минут или 12 часов, затем инкубировали с антителом против IFNα или носителем в течение 36 часов. Для SiMoA лизаты с примированным IFN-I прогоняли на SiMoA HD-1 или SR-X.

    Доступность данных.

    Все подтверждающие данные включены в рукопись.

    Благодарности

    Мы благодарим Эллисон Сова и Билла Янссена из центра микроскопии Mount Sinai, а также Людовика Дебюра и доктора Томаса Вишневски из Нью-Йоркского университета за их помощь с SiMoA (гранты AG08051 и R01AF058267). Источники финансирования следующие: Deutsche Forschungsgemeinschaft для J.

  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *